Result : EXP02008
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02008 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 1859285 |
| Right | 1859359 |
| Strand | - |
| Nucleotide Sequence | GTGGGTGGCGTCGAGTTCGTCGGTGCGAAAGGTACGACCGATCGAGATGATGTAGACCGGCAGCTCACGCGCTAG |
| Sequence | VGGVEFVGAKGTTDRDDVDRQLTR |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 24 |
++ More..
| Conservation Analysis |
No. of Species: 6
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1886014 | 1886088 | - | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 2 | 1859285 | 1859359 | - | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
| 3 | 6204718 | 6204780 | - | NC_022663.1 | Mycobacterium kansasii ATCC 12478 |
| 4 | 1635233 | 1635307 | - | NZ_AP022581.1 | Mycobacterium lacus |
| 5 | 3575873 | 3575935 | + | NZ_CP011269.1 | Mycolicibacterium fortuitum |
| 6 | 1817704 | 1817781 | - | NZ_CP009312.1 | Lawsonella clevelandensis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015848.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF09995.11 | 0.67 | 4 | 4169.0 | same-strand | ER-bound oxygenase mpaB/B'/Rubber oxygenase, catalytic domain |
| 2 | PF00934.22 | 0.67 | 4 | 2988.0 | opposite-strand | PE family |
| 3 | PF00211.22 | 0.67 | 4 | 1692.0 | opposite-strand | Adenylate and Guanylate cyclase catalytic domain |
| 4 | PF01409.22 | 1.0 | 6 | -74.0 | opposite-strand | tRNA synthetases class II core domain (F) |
| 5 | PF02912.20 | 1.0 | 6 | -74.0 | opposite-strand | Aminoacyl tRNA synthetase class II, N-terminal domain |
| 6 | PF03483.19 | 1.0 | 6 | 399.0 | opposite-strand | B3/4 domain |
| 7 | PF17759.3 | 1.0 | 6 | 399.0 | opposite-strand | Phenylalanyl tRNA synthetase beta chain CLM domain |
| 8 | PF03147.16 | 1.0 | 6 | 399.0 | opposite-strand | Ferredoxin-fold anticodon binding domain |
| 9 | PF01588.22 | 1.0 | 6 | 399.0 | opposite-strand | Putative tRNA binding domain |
| 10 | PF03484.17 | 1.0 | 6 | 399.0 | opposite-strand | tRNA synthetase B5 domain |
| 11 | PF02774.20 | 0.83 | 5 | 6217 | opposite-strand | Semialdehyde dehydrogenase, dimerisation domain |
| 12 | PF01118.26 | 0.83 | 5 | 6217 | opposite-strand | Semialdehyde dehydrogenase, NAD binding domain |
| 13 | PF01960.20 | 0.83 | 5 | 7272 | opposite-strand | ArgJ family |
| 14 | PF00696.30 | 0.67 | 4 | 7402.5 | opposite-strand | Amino acid kinase family |
++ More..