Result : EXP02007
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02007 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 1855055 |
| Right | 1855111 |
| Strand | - |
| Nucleotide Sequence | ATGCGACGTTTTTCATGCTTGTCATCAAGGTCGCCGAATACTTCTGCGGAGGCTTGA |
| Sequence | MRRFSCLSSRSPNTSAEA |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 18 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1881784 | 1881840 | - | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 2 | 1855055 | 1855111 | - | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015848.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00707.24 | 1.0 | 2 | 2177.0 | opposite-strand | Translation initiation factor IF-3, C-terminal domain |
| 2 | PF01632.21 | 1.0 | 2 | 1933.0 | opposite-strand | Ribosomal protein L35 |
| 3 | PF00453.20 | 1.0 | 2 | 1482.0 | opposite-strand | Ribosomal protein L20 |
| 4 | PF00588.21 | 1.0 | 2 | 667.0 | opposite-strand | SpoU rRNA Methylase family |
| 5 | PF08032.14 | 1.0 | 2 | 667.0 | opposite-strand | RNA 2'-O ribose methyltransferase substrate binding |
| 6 | PF09995.11 | 1.0 | 2 | -56.0 | same-strand | ER-bound oxygenase mpaB/B'/Rubber oxygenase, catalytic domain |
| 7 | PF00934.22 | 1.0 | 2 | 653.0 | opposite-strand | PE family |
| 8 | PF00211.22 | 1.0 | 2 | 1663.0 | opposite-strand | Adenylate and Guanylate cyclase catalytic domain |
| 9 | PF01409.22 | 1.0 | 2 | 3589.0 | opposite-strand | tRNA synthetases class II core domain (F) |
| 10 | PF02912.20 | 1.0 | 2 | 3589.0 | opposite-strand | Aminoacyl tRNA synthetase class II, N-terminal domain |
| 11 | PF03483.19 | 1.0 | 2 | 4647.0 | opposite-strand | B3/4 domain |
| 12 | PF17759.3 | 1.0 | 2 | 4647.0 | opposite-strand | Phenylalanyl tRNA synthetase beta chain CLM domain |
| 13 | PF03147.16 | 1.0 | 2 | 4647.0 | opposite-strand | Ferredoxin-fold anticodon binding domain |
| 14 | PF01588.22 | 1.0 | 2 | 4647.0 | opposite-strand | Putative tRNA binding domain |
| 15 | PF03484.17 | 1.0 | 2 | 4647.0 | opposite-strand | tRNA synthetase B5 domain |
++ More..