Result : EXP02006
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02006 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 185108 |
| Right | 185197 |
| Strand | - |
| Nucleotide Sequence | GTGGCCGCCACGGCGATGGTCATGCCGGCCGCGGCGATCAGGTTCCCGCGCACCGCGGTCTTGGGGCCGGTGAGCCCCATCAACCCGTAG |
| Sequence | VAATAMVMPAAAIRFPRTAVLGPVSPINP |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 29 |
++ More..
| Conservation Analysis |
No. of Species: 53
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 185108 | 185197 | - | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
| 2 | 191776 | 191865 | - | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 3 | 299398 | 299487 | - | NZ_LR130759.1 | Mycobacterium basiliense |
| 4 | 3520738 | 3520827 | - | NC_022663.1 | Mycobacterium kansasii ATCC 12478 |
| 5 | 3644893 | 3644982 | + | NZ_AP022575.1 | Mycobacterium shinjukuense |
| 6 | 5303012 | 5303110 | + | NC_016948.1 | Mycobacterium paraintracellulare |
| 7 | 5201851 | 5201949 | + | NC_016946.1 | Mycobacterium intracellulare ATCC 13950 |
| 8 | 4325703 | 4325777 | + | NZ_AP022581.1 | Mycobacterium lacus |
| 9 | 326388 | 326462 | - | NZ_AP018164.1 | Mycobacterium shigaense |
| 10 | 3940979 | 3941077 | + | NZ_AP022614.1 | Mycobacterium parmense |
| 11 | 1871133 | 1871207 | + | NZ_AP022615.1 | Mycobacterium heidelbergense |
| 12 | 1356789 | 1356878 | + | NZ_AP022606.1 | Mycobacterium branderi |
| 13 | 2002820 | 2002894 | - | NZ_AP022583.1 | Mycobacterium noviomagense |
| 14 | 4722669 | 4722758 | + | NZ_AP024310.1 | Mycobacterium heckeshornense |
| 15 | 5771983 | 5772072 | + | NC_015312.1 | Pseudonocardia dioxanivorans CB1190 |
| 16 | 2313343 | 2313441 | + | NZ_AP022568.1 | Mycobacterium simiae |
| 17 | 1445541 | 1445615 | + | NZ_AP017900.1 | Nocardia seriolae |
| 18 | 1875686 | 1875775 | - | NZ_CP058277.1 | Mycobacterium marinum |
| 19 | 512603 | 512692 | - | NZ_AP018410.1 | Mycobacterium pseudoshottsii JCM 15466 |
| 20 | 1360034 | 1360123 | - | NZ_AP022572.1 | Mycobacterium shottsii |
| 21 | 6134558 | 6134656 | - | NZ_AP022613.1 | Mycobacterium conspicuum |
| 22 | 5045055 | 5045153 | + | NZ_CP023147.1 | Mycobacterium marseillense |
| 23 | 3659637 | 3659735 | + | NZ_AP022587.1 | Mycobacterium stomatepiae |
| 24 | 1132092 | 1132166 | - | NZ_CP048813.1 | Rhodococcus triatomae |
| 25 | 5206183 | 5206272 | + | NZ_CP011530.1 | Mycobacteroides immunogenum |
| 26 | 2100797 | 2100871 | - | NZ_CP008953.1 | Amycolatopsis japonica |
| 27 | 4113833 | 4113931 | + | NZ_AP022590.1 | Mycobacterium mantenii |
| 28 | 4670725 | 4670814 | + | NZ_CP014955.1 | Mycobacteroides abscessus |
| 29 | 6600472 | 6600546 | + | NZ_CP016174.1 | Amycolatopsis orientalis |
| 30 | 2884321 | 2884410 | - | NZ_CP042430.1 | Baekduia soli |
| 31 | 5194091 | 5194180 | + | NZ_CP022088.2 | Nocardia brasiliensis |
| 32 | 2244251 | 2244340 | - | NC_022116.1 | Amycolatopsis mediterranei RB |
| 33 | 4865932 | 4866006 | + | NC_013441.1 | Gordonia bronchialis DSM 43247 |
| 34 | 2463608 | 2463697 | - | NZ_CP053564.1 | Pseudonocardia broussonetiae |
| 35 | 3941293 | 3941391 | + | NZ_CP015163.1 | Amycolatopsis albispora |
| 36 | 6672524 | 6672598 | + | NZ_AP023396.1 | Nocardia wallacei |
| 37 | 4714516 | 4714605 | + | NZ_AP018165.1 | [Mycobacterium] stephanolepidis |
| 38 | 4700872 | 4700961 | + | NZ_CP007220.1 | Mycobacteroides chelonae CCUG 47445 |
| 39 | 395598 | 395672 | + | NZ_CP026746.1 | Nocardia cyriacigeorgica |
| 40 | 3339869 | 3339958 | - | NZ_CP015235.1 | Rhodococcus fascians D188 |
| 41 | 3351940 | 3352038 | + | NZ_AP022576.1 | Mycobacterium florentinum |
| 42 | 4124013 | 4124087 | + | NZ_AP023172.1 | Rhodococcus qingshengii |
| 43 | 1998770 | 1998844 | - | NZ_LR134352.1 | Nocardia asteroides |
| 44 | 4347622 | 4347711 | + | NZ_CP010271.1 | Mycobacteroides saopaulense |
| 45 | 1102767 | 1102856 | - | NZ_CP018082.1 | Nocardia mangyaensis |
| 46 | 3283421 | 3283495 | + | NZ_CP033972.1 | Gordonia insulae |
| 47 | 6579099 | 6579173 | + | NC_021252.1 | Amycolatopsis keratiniphila |
| 48 | 5648802 | 5648891 | - | NZ_CP041695.1 | Nocardia otitidiscaviarum |
| 49 | 1597420 | 1597509 | - | NZ_CP016353.1 | Prauserella marina |
| 50 | 604859 | 604939 | - | NC_016906.1 | Gordonia polyisoprenivorans VH2 |
| 51 | 2707655 | 2707744 | - | NZ_CP012752.1 | Kibdelosporangium phytohabitans |
| 52 | 101925 | 102023 | - | NZ_CP015961.1 | Dietzia timorensis |
| 53 | 1250126 | 1250218 | - | NZ_CP009312.1 | Lawsonella clevelandensis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000962.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01262.23 | 1.0 | 53 | 382 | opposite-strand | Alanine dehydrogenase/PNT, C-terminal domain |
| 2 | PF05222.17 | 1.0 | 53 | 382 | opposite-strand | Alanine dehydrogenase/PNT, N-terminal domain |
| 3 | PF12769.9 | 1.0 | 53 | 47 | opposite-strand | 4TM region of pyridine nucleotide transhydrogenase, mitoch |
| 4 | PF02233.18 | 1.0 | 53 | -89 | opposite-strand | NAD(P) transhydrogenase beta subunit |
| 5 | PF00440.25 | 0.66 | 35 | 1610.0 | opposite-strand | Bacterial regulatory proteins, tetR family |
++ More..