Result : EXP02004
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02004 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 1708536 |
| Right | 1708652 |
| Strand | - |
| Nucleotide Sequence | GTGTGCCGTACGTCCGCCGACCACCAGGCCACGACGGCCGACGGCCGGCGGGCACAGGCGATTCACGTTCGCCATCGCAATACCCTTGCGGCCGCGCAGGAAAAGGGCCGACGGTGA |
| Sequence | VCRTSADHQATTADGRRAQAIHVRHRNTLAAAQEKGRR |
| Source of smORF | Transcriptional-level |
| Function | It is a short ORF coupled to a downstream gene whose start codon overlaps the stop codon of this ORF. This indicates that this smORF might be translationally coupled to downstream gene. Pubmed:26536359 |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Manually curated function from literature |
| Uniprot ID | |
| ORF Length (Amino Acid) | 38 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1732714 | 1732830 | - | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 2 | 1708536 | 1708652 | - | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015848.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01370.23 | 1.0 | 2 | 3476.5 | opposite-strand | NAD dependent epimerase/dehydratase family |
| 2 | PF05050.14 | 1.0 | 2 | 2747.0 | opposite-strand | Methyltransferase FkbM domain |
| 3 | PF13489.8 | 1.0 | 2 | 1010.0 | same-strand | Methyltransferase domain |
| 4 | PF08241.14 | 1.0 | 2 | 1010.0 | same-strand | Methyltransferase domain |
| 5 | PF13649.8 | 1.0 | 2 | 1010.0 | same-strand | Methyltransferase domain |
| 6 | PF08242.14 | 1.0 | 2 | 1010.0 | same-strand | Methyltransferase domain |
| 7 | PF00535.28 | 1.0 | 2 | 494.5 | both-strands | Glycosyl transferase family 2 |
| 8 | PF11139.10 | 1.0 | 2 | 219.0 | opposite-strand | Sap, sulfolipid-1-addressing protein |
| 9 | PF13641.8 | 1.0 | 2 | 992.0 | opposite-strand | Glycosyltransferase like family 2 |
| 10 | PF00501.30 | 1.0 | 2 | 3674.0 | opposite-strand | AMP-binding enzyme |
++ More..