Result : EXP02003
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02003 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 1697977 |
| Right | 1698039 |
| Strand | - |
| Nucleotide Sequence | GTGCAGCCTAACCACAACCCGAACCAGTGCCTACAGAACATGGCGCGCAACGGTTTACACTGA |
| Sequence | VQPNHNPNQCLQNMARNGLH |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 20 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1722152 | 1722214 | - | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 2 | 1697977 | 1698039 | - | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015848.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00132.26 | 1.0 | 2 | 2033.0 | same-strand | Bacterial transferase hexapeptide (six repeats) |
| 2 | PF14602.8 | 1.0 | 2 | 2033.0 | same-strand | Hexapeptide repeat of succinyl-transferase |
| 3 | PF08889.13 | 1.0 | 2 | 555.0 | same-strand | WbqC-like protein family |
| 4 | PF09594.12 | 1.0 | 2 | 56.0 | same-strand | Glycosyltransferase family 87 |
| 5 | PF08241.14 | 1.0 | 2 | 2252.5 | opposite-strand | Methyltransferase domain |
| 6 | PF08242.14 | 1.0 | 2 | 2252.5 | opposite-strand | Methyltransferase domain |
++ More..