Result : EXP02001
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02001 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 1692432 |
| Right | 1692521 |
| Strand | - |
| Nucleotide Sequence | ATGGCCAAGCGGTCTTTGCCGGAGGTGTTTCGGCCAGCCGCATGCCAAAGCGTAGAGTCAAAAACGAACAACGAGCCCGCCGCGCATTGA |
| Sequence | MAKRSLPEVFRPAACQSVESKTNNEPAAH |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 29 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1716603 | 1716692 | - | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 2 | 1692432 | 1692521 | - | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015848.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00144.26 | 1.0 | 2 | 3202.0 | opposite-strand | Beta-lactamase |
| 2 | PF08241.14 | 1.0 | 2 | 2512.0 | same-strand | Methyltransferase domain |
| 3 | PF13649.8 | 1.0 | 2 | 2512.0 | same-strand | Methyltransferase domain |
| 4 | PF13847.8 | 1.0 | 2 | 2512.0 | same-strand | Methyltransferase domain |
| 5 | PF08242.14 | 1.0 | 2 | 2512.0 | same-strand | Methyltransferase domain |
| 6 | PF07311.14 | 1.0 | 2 | 2086.0 | same-strand | Dodecin |
| 7 | PF00535.28 | 1.0 | 2 | 554.0 | opposite-strand | Glycosyl transferase family 2 |
| 8 | PF05721.15 | 1.0 | 2 | -89.0 | opposite-strand | Phytanoyl-CoA dioxygenase (PhyH) |
| 9 | PF00132.26 | 1.0 | 2 | 2760.0 | same-strand | Bacterial transferase hexapeptide (six repeats) |
| 10 | PF14602.8 | 1.0 | 2 | 2760.0 | same-strand | Hexapeptide repeat of succinyl-transferase |
++ More..