Result : EXP01995
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01995 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 1371683 |
| Right | 1371766 |
| Strand | - |
| Nucleotide Sequence | GTGAGCAGACGCAAAAGAACCCGATTCTGGTCGAAATTGGGTGCCGTTGCGTCTGCTCGGCGTACTAGGCTTTCCGGGGAATGA |
| Sequence | VSRRKRTRFWSKLGAVASARRTRLSGE |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 27 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1391775 | 1391858 | - | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 2 | 1371683 | 1371766 | - | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
| 3 | 3104979 | 3105047 | + | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
| 4 | 2336254 | 2336325 | + | NZ_AP022581.1 | Mycobacterium lacus |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015848.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF02416.18 | 0.67 | 2 | 3825.0 | opposite-strand | mttA/Hcf106 family |
| 2 | PF13344.8 | 0.67 | 2 | 2962.0 | same-strand | Haloacid dehalogenase-like hydrolase |
| 3 | PF13242.8 | 0.67 | 2 | 2962.0 | same-strand | HAD-hyrolase-like |
| 4 | PF03703.16 | 0.67 | 2 | 1172.5 | same-strand | Bacterial PH domain |
| 5 | PF10609.11 | 0.67 | 2 | 11.0 | same-strand | NUBPL iron-transfer P-loop NTPase |
| 6 | PF01883.21 | 0.67 | 2 | 11.0 | same-strand | Iron-sulfur cluster assembly protein |
| 7 | PF01656.25 | 0.67 | 2 | 11.0 | same-strand | CobQ/CobB/MinD/ParA nucleotide binding domain |
| 8 | PF06210.13 | 0.67 | 2 | 2556.0 | same-strand | Protein of unknown function (DUF1003) |
| 9 | PF03448.19 | 0.67 | 2 | 3095.0 | same-strand | MgtE intracellular N domain |
| 10 | PF00571.30 | 0.67 | 2 | 3095.0 | same-strand | CBS domain |
| 11 | PF13828.8 | 0.67 | 2 | 4464.0 | same-strand | Domain of unknown function (DUF4190) |
++ More..