Result : EXP01994
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01994 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 1357577 |
| Right | 1357651 |
| Strand | - |
| Nucleotide Sequence | ATGTCGTATCTGGTGGCGCCCCGGACGTGCTGGCATCGGCGGCAACGGATTTGGCGGGCATCGGCTCGGCATTGA |
| Sequence | MSYLVAPRTCWHRRQRIWRASARH |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 24 |
++ More..
| Conservation Analysis |
No. of Species: 4
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1377667 | 1377741 | - | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 2 | 1357577 | 1357651 | - | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
| 3 | 41948 | 42013 | + | NC_020813.1 | Bdellovibrio exovorus JSS |
| 4 | 1853188 | 1853265 | + | NZ_CP047349.1 | Proteus terrae subsp. cibarius |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015848.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00534.22 | 0.75 | 3 | 1962 | same-strand | Glycosyl transferases group 1 |
| 2 | PF00483.25 | 0.75 | 3 | 527 | opposite-strand | Nucleotidyl transferase |
++ More..