Result : EXP01992
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01992 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 1107379 |
| Right | 1107417 |
| Strand | - |
| Nucleotide Sequence | GTGTCAATGTTGTGCGCATGCCTACGGCCACGAGCATGA |
| Sequence | VSMLCACLRPRA |
| Source of smORF | Transcriptional-level |
| Function | It is a short ORF coupled to a downstream gene whose start codon overlaps the stop codon of this ORF. This indicates that this smORF might be translationally coupled to downstream gene. Pubmed:26536359 |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Manually curated function from literature |
| Uniprot ID | |
| ORF Length (Amino Acid) | 12 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1118186 | 1118224 | - | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 2 | 1107379 | 1107417 | - | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015848.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01741.20 | 1.0 | 2 | 5899.0 | same-strand | Large-conductance mechanosensitive channel, MscL |
| 2 | PF00005.29 | 1.0 | 2 | 4830.0 | opposite-strand | ABC transporter |
| 3 | PF02687.23 | 1.0 | 2 | 2270.0 | opposite-strand | FtsX-like permease family |
| 4 | PF07143.13 | 1.0 | 2 | 1103.0 | opposite-strand | CrtC N-terminal lipocalin domain |
| 5 | PF17186.6 | 1.0 | 2 | 1103.0 | opposite-strand | Lipocalin-like domain |
| 6 | PF00348.19 | 1.0 | 2 | -3.0 | same-strand | Polyprenyl synthetase |
| 7 | PF08666.14 | 1.0 | 2 | 26.0 | same-strand | SAF domain |
| 8 | PF09723.12 | 1.0 | 2 | 755.0 | same-strand | Zinc ribbon domain |
| 9 | PF01812.22 | 1.0 | 2 | 1161.0 | same-strand | 5-formyltetrahydrofolate cyclo-ligase family |
| 10 | PF00483.25 | 1.0 | 2 | 1855.0 | opposite-strand | Nucleotidyl transferase |
| 11 | PF12804.9 | 1.0 | 2 | 1855.0 | opposite-strand | MobA-like NTP transferase domain |
| 12 | PF03453.19 | 1.0 | 2 | 2852.0 | opposite-strand | MoeA N-terminal region (domain I and II) |
| 13 | PF03454.17 | 1.0 | 2 | 2852.0 | opposite-strand | MoeA C-terminal region (domain IV) |
| 14 | PF00994.26 | 1.0 | 2 | 2852.0 | opposite-strand | Probable molybdopterin binding domain |
++ More..