Result : EXP01990

Protein Information

• Protein name: EXP01990
• NCBI Accession ID: NC_000962.3
• Organism: Mycobacterium tuberculosis H37Rv
• Left: 1000104
• Right: 1000142
• Strand: -
• Nucleotide Sequence: ATGTCCAGCGCCCGCACCACCTCGGGGTCGGCCTGGTAG
• Sequence: MSSARTTSGSAW
• Source of smORF: Transcriptional-level
• Pubmed ID: 26536359
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 12

Conservation Analysis

No. of Species: 5

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	3352944	3352982	+	NZ_AP022582.1	Mycobacterium seoulense
2	2123302	2123340	+	NC_022663.1	Mycobacterium kansasii ATCC 12478
3	3194196	3194234	+	NZ_AP022619.1	Mycobacterium paraseoulense
4	1005210	1005248	-	NC_015848.1	Mycobacterium canettii CIPT 140010059
5	1000104	1000142	-	NC_000962.3	Mycobacterium tuberculosis H37Rv

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NC_022663.1

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF10944.10	1.0	5	2299	same-strand	Protein of unknown function (DUF2630)
2	PF00285.23	1.0	5	-38.0	opposite-strand	Citrate synthase, C-terminal domain
3	PF01243.22	0.6	3	762	opposite-strand	Pyridoxamine 5'-phosphate oxidase
4	PF10590.11	0.6	3	762	opposite-strand	Pyridoxine 5'-phosphate oxidase C-terminal dimerisation region
5	PF00691.22	0.6	3	2670	opposite-strand	OmpA family