Result : EXP01987
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01987 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 809895 |
| Right | 809939 |
| Strand | + |
| Nucleotide Sequence | GTGTCGCTTCCCGGGGCAGGACTGGGGCAGTGGGTTATCCGGTGA |
| Sequence | VSLPGAGLGQWVIR |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 14 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 825055 | 825099 | + | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 2 | 809895 | 809939 | + | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015848.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00252.20 | 1.0 | 2 | 4369.5 | same-strand | Ribosomal protein L16p/L10e |
| 2 | PF00831.25 | 1.0 | 2 | 4136.5 | same-strand | Ribosomal L29 protein |
| 3 | PF00366.22 | 1.0 | 2 | 3729.5 | same-strand | Ribosomal protein S17 |
| 4 | PF00884.25 | 1.0 | 2 | 1197.5 | same-strand | Sulfatase |
| 5 | PF03781.18 | 1.0 | 2 | 250.5 | same-strand | Sulfatase-modifying factor enzyme 1 |
| 6 | PF14494.8 | 1.0 | 2 | 88.0 | same-strand | Domain of unknown function (DUF4436) |
| 7 | PF00238.21 | 1.0 | 2 | 1433.5 | same-strand | Ribosomal protein L14p/L23e |
| 8 | PF17136.6 | 1.0 | 2 | 1802.5 | same-strand | Ribosomal proteins 50S L24/mitochondrial 39S L24 |
| 9 | PF00467.31 | 1.0 | 2 | 1802.5 | same-strand | KOW motif |
| 10 | PF00673.23 | 1.0 | 2 | 2119.5 | same-strand | ribosomal L5P family C-terminus |
| 11 | PF00281.21 | 1.0 | 2 | 2119.5 | same-strand | Ribosomal protein L5 |
| 12 | PF00253.23 | 1.0 | 2 | 2687.5 | same-strand | Ribosomal protein S14p/S29e |
++ More..