Result : EXP01986

Protein Information

• Protein name: EXP01986
• NCBI Accession ID: NC_000962.3
• Organism: Mycobacterium tuberculosis H37Rv
• Left: 798673
• Right: 798774
• Strand: +
• Nucleotide Sequence: ATGCTGCCGCCCGGATTGCCGACGTCGTGGCCCAGCGGTGCCCCAACGCGGTCCGCCGCGTCGATCCTTTCCACGTGGTGGCCTGGGCCACCGAGGCTCTAG
• Sequence: MLPPGLPTSWPSGAPTRSAASILSTWWPGPPRL
• Source of smORF: Transcriptional-level
• Pubmed ID: 26536359
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 33

Conservation Analysis

No. of Species: 3

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	798673	798774	+	NC_000962.3	Mycobacterium tuberculosis H37Rv
2	812595	812696	+	NC_015848.1	Mycobacterium canettii CIPT 140010059
3	4659663	4659755	+	NZ_CP044543.1	Bradyrhizobium betae

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NC_000962.3

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF02633.16	0.67	2	3230.0	same-strand	Creatinine amidohydrolase
2	PF00535.28	0.67	2	1742.5	same-strand	Glycosyl transferase family 2
3	PF13641.8	0.67	2	1742.5	same-strand	Glycosyltransferase like family 2
4	PF13506.8	0.67	2	1742.5	same-strand	Glycosyl transferase family 21
5	PF00732.21	0.67	2	301.5	same-strand	GMC oxidoreductase
6	PF05199.15	0.67	2	301.5	same-strand	GMC oxidoreductase
7	PF00338.24	0.67	2	2196.5	same-strand	Ribosomal protein S10p/S20e