Result : EXP01985
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01985 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 654258 |
| Right | 654317 |
| Strand | + |
| Nucleotide Sequence | GTGAGCTGCGTGCCGTGCTGGGCCACGAGCTGTCTCACGTCTACAACCGCGACATCCTGA |
| Sequence | VSCVPCWATSCLTSTTATS |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 19 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 667730 | 667789 | + | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 2 | 654258 | 654317 | + | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
| 3 | 4046960 | 4047019 | - | NZ_AP018165.1 | [Mycobacterium] stephanolepidis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000962.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF05305.16 | 0.67 | 2 | 3513.0 | opposite-strand | Protein of unknown function (DUF732) |
| 2 | PF13649.8 | 1.0 | 3 | 2754 | same-strand | Methyltransferase domain |
| 3 | PF08241.14 | 1.0 | 3 | 2754 | same-strand | Methyltransferase domain |
| 4 | PF08242.14 | 1.0 | 3 | 2754 | same-strand | Methyltransferase domain |
| 5 | PF01494.21 | 1.0 | 3 | 1503 | opposite-strand | FAD binding domain |
| 6 | PF00348.19 | 1.0 | 3 | 480 | same-strand | Polyprenyl synthetase |
| 7 | PF01435.20 | 1.0 | 3 | -59 | same-strand | Peptidase family M48 |
| 8 | PF07479.16 | 0.67 | 2 | 608.5 | opposite-strand | NAD-dependent glycerol-3-phosphate dehydrogenase C-terminus |
| 9 | PF01210.25 | 0.67 | 2 | 608.5 | opposite-strand | NAD-dependent glycerol-3-phosphate dehydrogenase N-terminus |
| 10 | PF03807.19 | 0.67 | 2 | 608.5 | opposite-strand | NADP oxidoreductase coenzyme F420-dependent |
| 11 | PF04461.15 | 0.67 | 2 | 3232.5 | opposite-strand | Protein of unknown function (DUF520) |
| 12 | PF00891.20 | 0.67 | 2 | 4002.5 | same-strand | O-methyltransferase domain |
| 13 | PF16864.7 | 0.67 | 2 | 4002.5 | same-strand | Dimerisation domain |
| 14 | PF00067.24 | 0.67 | 2 | 5152.5 | same-strand | Cytochrome P450 |
| 15 | PF13489.8 | 0.67 | 2 | 3362.5 | same-strand | Methyltransferase domain |
++ More..