Result : EXP01983
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01983 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 573837 |
| Right | 573920 |
| Strand | + |
| Nucleotide Sequence | GTGTACCACAGCGCCTTGTTCCGCACGACGACCGCGTGTCTTTTCGCGGGCGCGTGTTGTTGCCGCCCCCTTTGCCGCGCCTGA |
| Sequence | VYHSALFRTTTACLFAGACCCRPLCRA |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 27 |
++ More..
| Conservation Analysis |
No. of Species: 9
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 584177 | 584260 | + | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 2 | 573837 | 573920 | + | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
| 3 | 974760 | 974843 | + | NZ_CP025546.1 | Mycobacterium paragordonae |
| 4 | 3228361 | 3228447 | - | NZ_AP022575.1 | Mycobacterium shinjukuense |
| 5 | 3901002 | 3901085 | - | NZ_AP022581.1 | Mycobacterium lacus |
| 6 | 3525391 | 3525477 | - | NZ_AP022614.1 | Mycobacterium parmense |
| 7 | 393098 | 393184 | + | NZ_AP022613.1 | Mycobacterium conspicuum |
| 8 | 3025400 | 3025498 | - | NC_011146.1 | Citrifermentans bemidjiense Bem |
| 9 | 95914 | 95991 | + | NC_020300.1 | Bartonella australis Aust/NH1 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015848.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00795.24 | 0.78 | 7 | 4031 | opposite-strand | Carbon-nitrogen hydrolase |
| 2 | PF10698.11 | 0.78 | 7 | 3325 | opposite-strand | Protein of unknown function (DUF2505) |
| 3 | PF02873.18 | 0.78 | 7 | 2187 | same-strand | UDP-N-acetylenolpyruvoylglucosamine reductase, C-terminal domain |
| 4 | PF01565.25 | 0.67 | 6 | 2188.0 | same-strand | FAD binding domain |
| 5 | PF17964.3 | 0.78 | 7 | 772 | same-strand | Bacterial Ig domain |
| 6 | PF03734.16 | 0.78 | 7 | 772 | same-strand | L,D-transpeptidase catalytic domain |
| 7 | PF00106.27 | 0.78 | 7 | 36 | opposite-strand | short chain dehydrogenase |
| 8 | PF13561.8 | 0.78 | 7 | 36 | opposite-strand | Enoyl-(Acyl carrier protein) reductase |
| 9 | PF08659.12 | 0.78 | 7 | 36 | opposite-strand | KR domain |
| 10 | PF00480.22 | 0.78 | 7 | 63 | same-strand | ROK family |
| 11 | PF00534.22 | 0.78 | 7 | 1437 | same-strand | Glycosyl transferases group 1 |
| 12 | PF13439.8 | 0.78 | 7 | 1437 | same-strand | Glycosyltransferase Family 4 |
| 13 | PF13579.8 | 0.78 | 7 | 1437 | same-strand | Glycosyl transferase 4-like domain |
| 14 | PF13692.8 | 0.78 | 7 | 1437 | same-strand | Glycosyl transferases group 1 |
| 15 | PF13524.8 | 0.78 | 7 | 1437 | same-strand | Glycosyl transferases group 1 |
| 16 | PF10722.11 | 0.67 | 6 | 2774.5 | same-strand | Putative bacterial sensory transduction regulator |
++ More..