Result : EXP01982
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01982 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 546343 |
| Right | 546411 |
| Strand | + |
| Nucleotide Sequence | ATGCGGCTATACGGAGTCCCGATCACGGCGTCCTCGCTGGCGATCACAATGTCGGCACACAGCGCGTAG |
| Sequence | MRLYGVPITASSLAITMSAHSA |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 22 |
++ More..
| Conservation Analysis |
No. of Species: 10
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 556623 | 556691 | + | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 2 | 546343 | 546411 | + | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
| 3 | 3887671 | 3887739 | + | NZ_AP022567.1 | Mycolicibacterium mageritense |
| 4 | 3984602 | 3984670 | + | NC_022663.1 | Mycobacterium kansasii ATCC 12478 |
| 5 | 1671247 | 1671315 | - | NZ_AP022599.1 | Mycolicibacterium pulveris |
| 6 | 290057 | 290125 | - | NZ_AP022574.1 | Mycolicibacterium psychrotolerans |
| 7 | 663449 | 663517 | + | NZ_LR134356.1 | Mycolicibacterium aurum |
| 8 | 5998359 | 5998427 | - | NZ_AP022560.1 | Mycolicibacterium moriokaense |
| 9 | 2042974 | 2043033 | + | NC_004113.1 | Thermosynechococcus vestitus BP-1 |
| 10 | 1919500 | 1919559 | + | NZ_AP018202.1 | Thermostichus vulcanus NIES-2134 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015848.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00378.22 | 0.8 | 8 | -68.0 | opposite-strand | Enoyl-CoA hydratase/isomerase |
| 2 | PF00171.24 | 0.7 | 7 | 2890.0 | same-strand | Aldehyde dehydrogenase family |
++ More..