| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01981 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 510450 |
| Right | 510518 |
| Strand | + |
| Nucleotide Sequence | GTGGCGATAACCAGGGCGACCGGCCAGTCGATGAGTTCGAGGGCAGCGAGTGCCGCCAGACCTCCGTAG |
| Sequence | VAITRATGQSMSSRAASAARPP |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 22 |
| Conservation Analysis |
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 520768 | 520836 | + | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 2 | 510450 | 510518 | + | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
| 3 | 3289836 | 3289913 | - | NZ_AP022575.1 | Mycobacterium shinjukuense |
| 4 | 4888044 | 4888109 | + | NZ_AP022582.1 | Mycobacterium seoulense |
| 5 | 658822 | 658884 | + | NZ_AP018164.1 | Mycobacterium shigaense |
| 6 | 4682977 | 4683042 | + | NZ_AP022619.1 | Mycobacterium paraseoulense |
| 7 | 4378543 | 4378608 | - | NZ_AP024310.1 | Mycobacterium heckeshornense |
| 8 | 901538 | 901609 | + | NZ_CP025546.1 | Mycobacterium paragordonae |
| 9 | 4128004 | 4128066 | + | NZ_AP022569.1 | Mycobacterium cookii |
| 10 | 713060 | 713125 | + | NZ_LR130759.1 | Mycobacterium basiliense |
| 11 | 219009 | 219074 | - | NZ_AP022610.1 | Mycolicibacterium madagascariense |
| Neighborhood Conservation Analysis |
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01964.20 | 0.64 | 7 | 1293 | opposite-strand | Radical SAM ThiC family |
| 2 | PF00122.22 | 0.82 | 9 | 184 | opposite-strand | E1-E2 ATPase |
| 3 | PF00702.28 | 0.82 | 9 | 184 | opposite-strand | haloacid dehalogenase-like hydrolase |
| 4 | PF00689.23 | 0.82 | 9 | 184 | opposite-strand | Cation transporting ATPase, C-terminus |
| 5 | PF03372.25 | 0.91 | 10 | 5337.0 | opposite-strand | Endonuclease/Exonuclease/phosphatase family |
| 6 | PF01327.23 | 0.82 | 9 | 6980 | opposite-strand | Polypeptide deformylase |