Result : EXP01978
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01978 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 4273660 |
| Right | 4273728 |
| Strand | + |
| Nucleotide Sequence | GTGGGTTCATGCCATGCACTCGCGACCGCGGGAGCCGGCGAACCCGGCGCCACACATAATCCAGATTGA |
| Sequence | VGSCHALATAGAGEPGATHNPD |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 22 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4273660 | 4273728 | + | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
| 2 | 4340828 | 4340899 | + | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000962.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01040.20 | 1.0 | 2 | 3826.0 | opposite-strand | UbiA prenyltransferase family |
| 2 | PF01569.23 | 1.0 | 2 | 3286.0 | opposite-strand | PAP2 superfamily |
| 3 | PF19320.1 | 1.0 | 2 | 1380.0 | opposite-strand | Galactofuranosyltransferase-2, domain 3 |
| 4 | PF17994.3 | 1.0 | 2 | 1380.0 | opposite-strand | Galactofuranosyltransferase 2 N-terminal |
| 5 | PF13641.8 | 1.0 | 2 | 1380.0 | opposite-strand | Glycosyltransferase like family 2 |
| 6 | PF03275.15 | 1.0 | 2 | 184.0 | opposite-strand | UDP-galactopyranose mutase |
| 7 | PF13450.8 | 1.0 | 2 | 184.0 | opposite-strand | NAD(P)-binding Rossmann-like domain |
| 8 | PF01744.22 | 1.0 | 2 | 11.0 | same-strand | GLTT repeat (6 copies) |
| 9 | PF08310.13 | 1.0 | 2 | 1015.5 | same-strand | LGFP repeat |
| 10 | PF01510.27 | 1.0 | 2 | 1015.5 | same-strand | N-acetylmuramoyl-L-alanine amidase |
| 11 | PF00934.22 | 1.0 | 2 | 2830.5 | same-strand | PE family |
| 12 | PF08282.14 | 1.0 | 2 | 4633.0 | opposite-strand | haloacid dehalogenase-like hydrolase |
++ More..