Result : EXP01972

Protein Information

• Protein name: EXP01972
• NCBI Accession ID: NC_000962.3
• Organism: Mycobacterium tuberculosis H37Rv
• Left: 4092938
• Right: 4093033
• Strand: +
• Nucleotide Sequence: GTGAACGGTTTGACGGTGATCCGGACTGCGCGCTCGCTGAGCGGCCTACGCCCACGCTGTCGGTCAGATTGCGTCGATGAATCCTATGCGCTCTGA
• Sequence: VNGLTVIRTARSLSGLRPRCRSDCVDESYAL
• Source of smORF: Transcriptional-level
• Pubmed ID: 26536359
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 31

Conservation Analysis

No. of Species: 2

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	4092938	4093033	+	NC_000962.3	Mycobacterium tuberculosis H37Rv
2	4161319	4161414	+	NC_015848.1	Mycobacterium canettii CIPT 140010059

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NC_000962.3

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF00313.24	1.0	2	5735.5	opposite-strand	'Cold-shock' DNA-binding domain
2	PF00270.31	1.0	2	3170.5	same-strand	DEAD/DEAH box helicase
3	PF09369.12	1.0	2	3170.5	same-strand	Domain of unknown function (DUF1998)
4	PF00271.33	1.0	2	3170.5	same-strand	Helicase conserved C-terminal domain
5	PF00934.22	1.0	2	1421	same-strand	PE family
6	PF18621.3	1.0	2	60.0	same-strand	Family of unknown function (DUF5628)
7	PF18007.3	1.0	2	60.0	same-strand	Domain of unknown function (DUF5593)
8	PF14029.8	1.0	2	3045.5	opposite-strand	Protein of unknown function (DUF4244)
9	PF00482.25	1.0	2	3261.5	opposite-strand	Type II secretion system (T2SS), protein F