Result : EXP01971
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01971 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 4069158 |
| Right | 4069199 |
| Strand | + |
| Nucleotide Sequence | GTGACGATCCATGTCGGTTGGCCGTTGGCGCCGCCGCGGTGA |
| Sequence | VTIHVGWPLAPPR |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 13 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4124559 | 4124600 | + | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 2 | 4069158 | 4069199 | + | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015848.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01171.22 | 1.0 | 2 | 4286.5 | opposite-strand | PP-loop family |
| 2 | PF09179.13 | 1.0 | 2 | 4286.5 | opposite-strand | TilS substrate binding domain |
| 3 | PF10103.11 | 1.0 | 2 | 3234.5 | opposite-strand | Zincin-like metallopeptidase |
| 4 | PF00719.21 | 1.0 | 2 | 1247.5 | same-strand | Inorganic pyrophosphatase |
| 5 | PF04332.17 | 1.0 | 2 | 104.0 | opposite-strand | Protein of unknown function (DUF475) |
| 6 | PF03741.18 | 1.0 | 2 | 104.0 | opposite-strand | Integral membrane protein TerC family |
| 7 | PF10066.11 | 1.0 | 2 | 2037.0 | same-strand | Uncharacterized conserved protein (DUF2304) |
| 8 | PF05721.15 | 1.0 | 2 | 2592.0 | same-strand | Phytanoyl-CoA dioxygenase (PhyH) |
| 9 | PF16363.7 | 1.0 | 2 | 3468.0 | opposite-strand | GDP-mannose 4,6 dehydratase |
| 10 | PF01370.23 | 1.0 | 2 | 3468.0 | opposite-strand | NAD dependent epimerase/dehydratase family |
| 11 | PF01073.21 | 1.0 | 2 | 3468.0 | opposite-strand | 3-beta hydroxysteroid dehydrogenase/isomerase family |
++ More..