Protein Information |
Information Type | Description |
---|---|
Protein name | EXP01971 |
NCBI Accession ID | NC_000962.3 |
Organism | Mycobacterium tuberculosis H37Rv |
Left | 4069158 |
Right | 4069199 |
Strand | + |
Nucleotide Sequence | GTGACGATCCATGTCGGTTGGCCGTTGGCGCCGCCGCGGTGA |
Sequence | VTIHVGWPLAPPR |
Source of smORF | Transcriptional-level |
Function | |
Pubmed ID | 26536359 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 13 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 4124559 | 4124600 | + | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
2 | 4069158 | 4069199 | + | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF01171.22 | 1.0 | 2 | 4286.5 | opposite-strand | PP-loop family |
2 | PF09179.13 | 1.0 | 2 | 4286.5 | opposite-strand | TilS substrate binding domain |
3 | PF10103.11 | 1.0 | 2 | 3234.5 | opposite-strand | Zincin-like metallopeptidase |
4 | PF00719.21 | 1.0 | 2 | 1247.5 | same-strand | Inorganic pyrophosphatase |
5 | PF04332.17 | 1.0 | 2 | 104.0 | opposite-strand | Protein of unknown function (DUF475) |
6 | PF03741.18 | 1.0 | 2 | 104.0 | opposite-strand | Integral membrane protein TerC family |
7 | PF10066.11 | 1.0 | 2 | 2037.0 | same-strand | Uncharacterized conserved protein (DUF2304) |
8 | PF05721.15 | 1.0 | 2 | 2592.0 | same-strand | Phytanoyl-CoA dioxygenase (PhyH) |
9 | PF16363.7 | 1.0 | 2 | 3468.0 | opposite-strand | GDP-mannose 4,6 dehydratase |
10 | PF01370.23 | 1.0 | 2 | 3468.0 | opposite-strand | NAD dependent epimerase/dehydratase family |
11 | PF01073.21 | 1.0 | 2 | 3468.0 | opposite-strand | 3-beta hydroxysteroid dehydrogenase/isomerase family |