Protein Information |
Information Type | Description |
---|---|
Protein name | EXP01969 |
NCBI Accession ID | NC_000962.3 |
Organism | Mycobacterium tuberculosis H37Rv |
Left | 4030458 |
Right | 4030523 |
Strand | + |
Nucleotide Sequence | GTGCTTTCCACGCGGCTACCGGATTGGTGTTGGGCATGCCTCACATACTGCCGGAACCGTCGGTGA |
Sequence | VLSTRLPDWCWACLTYCRNRR |
Source of smORF | Transcriptional-level |
Function | |
Pubmed ID | 26536359 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 21 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 4085070 | 4085135 | + | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
2 | 4030458 | 4030523 | + | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
3 | 2719666 | 2719731 | + | NC_022663.1 | Mycobacterium kansasii ATCC 12478 |
4 | 5104517 | 5104582 | + | NZ_LR130759.1 | Mycobacterium basiliense |
5 | 974649 | 974714 | + | NZ_CP058277.1 | Mycobacterium marinum |
6 | 5700993 | 5701058 | + | NZ_AP018410.1 | Mycobacterium pseudoshottsii JCM 15466 |
7 | 539391 | 539456 | + | NZ_AP022572.1 | Mycobacterium shottsii |
8 | 4337322 | 4337387 | + | NZ_LT906483.1 | Mycolicibacterium thermoresistibile |
9 | 4219180 | 4219245 | - | NZ_AP022576.1 | Mycobacterium florentinum |
10 | 4191619 | 4191684 | - | NZ_AP022575.1 | Mycobacterium shinjukuense |
11 | 6266890 | 6266955 | + | NZ_CP025546.1 | Mycobacterium paragordonae |
12 | 5722493 | 5722561 | + | NC_008726.1 | Mycolicibacterium vanbaalenii PYR-1 |
13 | 2237392 | 2237466 | - | NZ_CP009215.1 | Corynebacterium ureicelerivorans |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF13481.8 | 0.92 | 12 | 2599.0 | same-strand | AAA domain |
2 | PF10635.11 | 0.85 | 11 | 1504 | same-strand | DisA bacterial checkpoint controller linker region |
3 | PF02457.18 | 0.92 | 12 | 1504.0 | same-strand | DisA bacterial checkpoint controller nucleotide-binding |
4 | PF00484.21 | 0.92 | 12 | -36 | opposite-strand | Carbonic anhydrase |
5 | PF00730.27 | 0.69 | 9 | -3 | same-strand | HhH-GPD superfamily base excision DNA repair protein |
6 | PF00633.25 | 0.92 | 12 | -3.0 | same-strand | Helix-hairpin-helix motif |