Result : EXP01968
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01968 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 4012395 |
| Right | 4012463 |
| Strand | + |
| Nucleotide Sequence | ATGACGGAAGAGAGGACGGGTCTTGACCGAGGCAATTGGAGACGAGCCACTCGGCGACCACGTCCTTGA |
| Sequence | MTEERTGLDRGNWRRATRRPRP |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 22 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4067001 | 4067069 | + | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 2 | 4012395 | 4012463 | + | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015848.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01613.20 | 1.0 | 2 | 3107.0 | opposite-strand | Flavin reductase like domain |
| 2 | PF00903.27 | 1.0 | 2 | 2196.0 | opposite-strand | Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily |
| 3 | PF00561.22 | 1.0 | 2 | 1324.0 | opposite-strand | alpha/beta hydrolase fold |
| 4 | PF12697.9 | 1.0 | 2 | 1324.0 | opposite-strand | Alpha/beta hydrolase family |
| 5 | PF12146.10 | 1.0 | 2 | 1324.0 | opposite-strand | Serine aminopeptidase, S33 |
| 6 | PF08028.13 | 1.0 | 2 | 125.0 | opposite-strand | Acyl-CoA dehydrogenase, C-terminal domain |
| 7 | PF00111.29 | 1.0 | 2 | -46.0 | same-strand | 2Fe-2S iron-sulfur cluster binding domain |
| 8 | PF00175.23 | 1.0 | 2 | -46.0 | same-strand | Oxidoreductase NAD-binding domain |
| 9 | PF00441.26 | 1.0 | 2 | 1617.0 | opposite-strand | Acyl-CoA dehydrogenase, C-terminal domain |
| 10 | PF02771.18 | 1.0 | 2 | 1617.0 | opposite-strand | Acyl-CoA dehydrogenase, N-terminal domain |
| 11 | PF02770.21 | 1.0 | 2 | 1617.0 | opposite-strand | Acyl-CoA dehydrogenase, middle domain |
| 12 | PF17925.3 | 1.0 | 2 | 3961.0 | same-strand | Tetracyclin repressor-like, C-terminal domain |
| 13 | PF00440.25 | 1.0 | 2 | 3961.0 | same-strand | Bacterial regulatory proteins, tetR family |
| 14 | PF13377.8 | 1.0 | 2 | 4629.0 | opposite-strand | Periplasmic binding protein-like domain |
| 15 | PF13407.8 | 1.0 | 2 | 4629.0 | opposite-strand | Periplasmic binding protein domain |
++ More..