Result : EXP01967
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01967 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 3903005 |
| Right | 3903091 |
| Strand | + |
| Nucleotide Sequence | ATGCAGCAAGCGACGGCACCGCAACCGCTGGCAGCGCGCCAGTTGGTTCGACGGCGCCTGGCCGAGGCATATGATGGCGCGTTCTGA |
| Sequence | MQQATAPQPLAARQLVRRRLAEAYDGAF |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 28 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3960910 | 3960996 | + | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 2 | 3903005 | 3903091 | + | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015848.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01734.24 | 1.0 | 2 | 4120.0 | same-strand | Patatin-like phospholipase |
| 2 | PF03007.18 | 1.0 | 2 | 2603.0 | opposite-strand | Wax ester synthase-like Acyl-CoA acyltransferase domain |
| 3 | PF06974.15 | 1.0 | 2 | 2603.0 | opposite-strand | WS/DGAT C-terminal domain |
| 4 | PF11139.10 | 1.0 | 2 | 1823.0 | opposite-strand | Sap, sulfolipid-1-addressing protein |
| 5 | PF14041.8 | 1.0 | 2 | 332.5 | opposite-strand | LppP/LprE lipoprotein |
| 6 | PF03816.16 | 1.0 | 2 | -13.0 | same-strand | LytR cpsA psr family |
| 7 | PF13399.8 | 1.0 | 2 | -13.0 | same-strand | LytR cell envelope-related transcriptional attenuator |
| 8 | PF13561.8 | 1.0 | 2 | 1531.0 | opposite-strand | Enoyl-(Acyl carrier protein) reductase |
| 9 | PF00106.27 | 1.0 | 2 | 1531.0 | opposite-strand | short chain dehydrogenase |
| 10 | PF08659.12 | 1.0 | 2 | 1531.0 | opposite-strand | KR domain |
| 11 | PF07681.14 | 1.0 | 2 | 2639.0 | same-strand | DoxX |
| 12 | PF13564.8 | 1.0 | 2 | 2639.0 | same-strand | DoxX-like family |
| 13 | PF07859.15 | 1.0 | 2 | 3083.0 | opposite-strand | alpha/beta hydrolase fold |
| 14 | PF03551.16 | 1.0 | 2 | 4576.0 | same-strand | Transcriptional regulator PadR-like family |
++ More..