Result : EXP01965

Protein Information

• Protein name: EXP01965
• NCBI Accession ID: NC_000962.3
• Organism: Mycobacterium tuberculosis H37Rv
• Left: 387083
• Right: 387130
• Strand: +
• Nucleotide Sequence: GTGACGGCTAGTGACAAATGCAGCGACTTTCGGGGAAACGGGCATTGA
• Sequence: VTASDKCSDFRGNGH
• Source of smORF: Transcriptional-level
• Pubmed ID: 26536359
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 15

Conservation Analysis

No. of Species: 3

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	394840	394887	+	NC_015848.1	Mycobacterium canettii CIPT 140010059
2	387083	387130	+	NC_000962.3	Mycobacterium tuberculosis H37Rv
3	1007442	1007486	+	NZ_CP009285.1	Paenibacillus borealis

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NC_015848.1

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF11259.10	0.67	2	3542.0	opposite-strand	Protein of unknown function (DUF3060)
2	PF02426.18	0.67	2	1934.0	same-strand	Muconolactone delta-isomerase
3	PF03009.19	0.67	2	1173.0	opposite-strand	Glycerophosphoryl diester phosphodiesterase family
4	PF13653.8	0.67	2	1173.0	opposite-strand	Glycerophosphoryl diester phosphodiesterase family
5	PF01470.19	0.67	2	18.0	same-strand	Pyroglutamyl peptidase
6	PF00692.21	0.67	2	1452.5	same-strand	dUTPase
7	PF03721.16	0.67	2	2130.5	same-strand	UDP-glucose/GDP-mannose dehydrogenase family, NAD binding domain
8	PF00984.21	0.67	2	2130.5	same-strand	UDP-glucose/GDP-mannose dehydrogenase family, central domain
9	PF03720.17	0.67	2	2130.5	same-strand	UDP-glucose/GDP-mannose dehydrogenase family, UDP binding domain
10	PF02585.19	0.67	2	3450.5	opposite-strand	GlcNAc-PI de-N-acetylase