Result : EXP01960
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01960 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 3691873 |
| Right | 3691962 |
| Strand | + |
| Nucleotide Sequence | GTGGGCGAGAATGCGTGTCGAGATTTCCTCGTTGACCACCGGCGGCACCCCCCGACGGTATTGCAGCGTGTGCTCGATCGCCAACGGTAA |
| Sequence | VGENACRDFLVDHRRHPPTVLQRVLDRQR |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 29 |
++ More..
| Conservation Analysis |
No. of Species: 13
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3753046 | 3753135 | + | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 2 | 3691873 | 3691962 | + | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
| 3 | 5265418 | 5265510 | + | NZ_AP022560.1 | Mycolicibacterium moriokaense |
| 4 | 908294 | 908392 | + | NZ_AP022599.1 | Mycolicibacterium pulveris |
| 5 | 3518986 | 3519087 | - | NZ_AP022600.1 | Mycolicibacterium tokaiense |
| 6 | 955532 | 955621 | - | NZ_CP011883.2 | Mycobacterium haemophilum DSM 44634 |
| 7 | 3297582 | 3297677 | + | NZ_LT906469.1 | Mycolicibacter terrae |
| 8 | 1340407 | 1340505 | - | NZ_LR134356.1 | Mycolicibacterium aurum |
| 9 | 1592439 | 1592534 | - | NZ_AP022618.1 | Mycolicibacterium insubricum |
| 10 | 1920463 | 1920558 | - | NZ_AP022570.1 | Mycolicibacterium poriferae |
| 11 | 3521219 | 3521314 | + | NZ_AP022617.1 | Mycolicibacterium monacense |
| 12 | 1438450 | 1438548 | - | NZ_AP022610.1 | Mycolicibacterium madagascariense |
| 13 | 1809417 | 1809491 | - | NZ_CP011269.1 | Mycolicibacterium fortuitum |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015848.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01266.26 | 0.69 | 9 | 2547 | opposite-strand | FAD dependent oxidoreductase |
| 2 | PF16901.7 | 0.62 | 8 | 2489.0 | opposite-strand | C-terminal domain of alpha-glycerophosphate oxidase |
| 3 | PF07992.16 | 0.85 | 11 | 1852 | opposite-strand | Pyridine nucleotide-disulphide oxidoreductase |
| 4 | PF02852.24 | 0.85 | 11 | 1852 | opposite-strand | Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain |
| 5 | PF00070.29 | 0.85 | 11 | 1852 | opposite-strand | Pyridine nucleotide-disulphide oxidoreductase |
| 6 | PF13772.8 | 0.92 | 12 | 1347.0 | same-strand | AIG2-like family |
| 7 | PF06094.14 | 0.62 | 8 | 303.5 | same-strand | Gamma-glutamyl cyclotransferase, AIG2-like |
| 8 | PF01546.30 | 1.0 | 13 | -95 | opposite-strand | Peptidase family M20/M25/M40 |
| 9 | PF07687.16 | 0.85 | 11 | 840 | opposite-strand | Peptidase dimerisation domain |
| 10 | PF01048.22 | 1.0 | 13 | 2084 | same-strand | Phosphorylase superfamily |
++ More..