Result : EXP01959
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01959 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 3503301 |
| Right | 3503396 |
| Strand | + |
| Nucleotide Sequence | ATGAGCCGTTATTACGCCGAGCGTGAACTCAGTGCAAGAACGCACGCGAAAAATCGCACTGGGTACACGCTCGGCGAAAGGATGGTGCACCAGTGA |
| Sequence | MSRYYAERELSARTHAKNRTGYTLGERMVHQ |
| Source of smORF | Transcriptional-level |
| Function | It is a short ORF coupled to a downstream gene whose start codon overlaps the stop codon of this ORF. This indicates that this smORF might be translationally coupled to downstream gene. Pubmed:26536359 |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Manually curated function from literature |
| Uniprot ID | |
| ORF Length (Amino Acid) | 31 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3558338 | 3558433 | + | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 2 | 3503301 | 3503396 | + | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015848.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00072.26 | 1.0 | 2 | 4054.5 | opposite-strand | Response regulator receiver domain |
| 2 | PF00196.21 | 1.0 | 2 | 4054.5 | opposite-strand | Bacterial regulatory proteins, luxR family |
| 3 | PF08281.14 | 1.0 | 2 | 4054.5 | opposite-strand | Sigma-70, region 4 |
| 4 | PF00582.28 | 1.0 | 2 | 3220.5 | opposite-strand | Universal stress protein family |
| 5 | PF00823.21 | 1.0 | 2 | 365 | same-strand | PPE family |
| 6 | PF12484.10 | 1.0 | 2 | 365 | same-strand | PPE-SVP subfamily C-terminal region |
| 7 | PF00459.27 | 1.0 | 2 | -3.0 | same-strand | Inositol monophosphatase family |
| 8 | PF04055.23 | 1.0 | 2 | 799.0 | same-strand | Radical SAM superfamily |
| 9 | PF00441.26 | 1.0 | 2 | 2681.0 | same-strand | Acyl-CoA dehydrogenase, C-terminal domain |
| 10 | PF02771.18 | 1.0 | 2 | 1967.5 | same-strand | Acyl-CoA dehydrogenase, N-terminal domain |
| 11 | PF08028.13 | 1.0 | 2 | 2681.0 | same-strand | Acyl-CoA dehydrogenase, C-terminal domain |
| 12 | PF02770.21 | 1.0 | 2 | 2681.0 | same-strand | Acyl-CoA dehydrogenase, middle domain |
| 13 | PF00107.28 | 1.0 | 2 | 4698.0 | same-strand | Zinc-binding dehydrogenase |
| 14 | PF13602.8 | 1.0 | 2 | 4698.0 | same-strand | Zinc-binding dehydrogenase |
++ More..