Result : EXP01957
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01957 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 333024 |
| Right | 333080 |
| Strand | + |
| Nucleotide Sequence | GTGAAGGGGTCGTCGGCCGCAAGCAGTCGATCGAACCAGGGGCGGACGGTTCGGTGA |
| Sequence | VKGSSAASSRSNQGRTVR |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 18 |
++ More..
| Conservation Analysis |
No. of Species: 4
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 841284 | 841340 | - | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
| 2 | 333024 | 333080 | + | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
| 3 | 339785 | 339841 | + | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 4 | 851966 | 852022 | - | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 5 | 3503918 | 3503974 | - | NZ_AP022575.1 | Mycobacterium shinjukuense |
| 6 | 4149024 | 4149080 | - | NZ_AP022581.1 | Mycobacterium lacus |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_AP022581.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01402.23 | 1.0 | 4 | 80 | opposite-strand | Ribbon-helix-helix protein, copG family |
| 2 | PF01850.23 | 1.0 | 4 | -56.0 | opposite-strand | PIN domain |
| 3 | PF00440.25 | 0.75 | 3 | 2699 | opposite-strand | Bacterial regulatory proteins, tetR family |
| 4 | PF00903.27 | 1.0 | 4 | 2026.0 | same-strand | Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily |
| 5 | PF13669.8 | 1.0 | 4 | 2026.0 | same-strand | Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily |
| 6 | PF09995.11 | 1.0 | 4 | 342.5 | same-strand | ER-bound oxygenase mpaB/B'/Rubber oxygenase, catalytic domain |
| 7 | PF00823.21 | 0.75 | 3 | 1932.0 | same-strand | PPE family |
| 8 | PF18878.2 | 0.75 | 3 | 1932.0 | same-strand | PPE-PPW subfamily C-terminal region |
| 9 | PF04072.16 | 0.75 | 3 | 2359 | same-strand | Leucine carboxyl methyltransferase |
++ More..