Result : EXP01953
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01953 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 2835437 |
| Right | 2835484 |
| Strand | + |
| Nucleotide Sequence | GTGAGATTTCACGCGAGAGCGCAAGGCCTGTTAATGTGCCTTGGCTAG |
| Sequence | VRFHARAQGLLMCLG |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 15 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2906337 | 2906384 | + | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 2 | 2835437 | 2835484 | + | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015848.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF14367.8 | 1.0 | 2 | 4098.5 | opposite-strand | Domain of unknown function (DUF4411) |
| 2 | PF06114.15 | 1.0 | 2 | 2854.5 | opposite-strand | IrrE N-terminal-like domain |
| 3 | PF01381.24 | 1.0 | 2 | 2854.5 | opposite-strand | Helix-turn-helix |
| 4 | PF17964.3 | 1.0 | 2 | 102.0 | opposite-strand | Bacterial Ig domain |
| 5 | PF03734.16 | 1.0 | 2 | 102.0 | opposite-strand | L,D-transpeptidase catalytic domain |
| 6 | PF12277.10 | 1.0 | 2 | 1004.0 | opposite-strand | Protein of unknown function (DUF3618) |
| 7 | PF00578.23 | 1.0 | 2 | 1296.5 | same-strand | AhpC/TSA family |
| 8 | PF08534.12 | 1.0 | 2 | 1296.5 | same-strand | Redoxin |
| 9 | PF01546.30 | 1.0 | 2 | 1741.5 | opposite-strand | Peptidase family M20/M25/M40 |
| 10 | PF07687.16 | 1.0 | 2 | 1741.5 | opposite-strand | Peptidase dimerisation domain |
| 11 | PF01648.22 | 1.0 | 2 | 3150.5 | opposite-strand | 4'-phosphopantetheinyl transferase superfamily |
++ More..