Result : EXP01952
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01952 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 2728515 |
| Right | 2728565 |
| Strand | + |
| Nucleotide Sequence | ATGGCCGTCGGAGGCCAGCCACCAGCGCACATGCCTGCACGGTGCACCTAA |
| Sequence | MAVGGQPPAHMPARCT |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 16 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2728515 | 2728565 | + | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
| 2 | 2791778 | 2791828 | + | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000962.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00578.23 | 1.0 | 2 | 1735.0 | same-strand | AhpC/TSA family |
| 2 | PF08534.12 | 1.0 | 2 | 1735.0 | same-strand | Redoxin |
| 3 | PF02627.22 | 1.0 | 2 | 1176.0 | same-strand | Carboxymuconolactone decarboxylase family |
| 4 | PF00823.21 | 1.0 | 2 | 595.0 | opposite-strand | PPE family |
| 5 | PF00934.22 | 1.0 | 2 | 249.0 | opposite-strand | PE family |
| 6 | PF00924.20 | 1.0 | 2 | 550.0 | opposite-strand | Mechanosensitive ion channel |
| 7 | PF00027.31 | 1.0 | 2 | 550.0 | opposite-strand | Cyclic nucleotide-binding domain |
| 8 | PF00211.22 | 1.0 | 2 | 1992.0 | opposite-strand | Adenylate and Guanylate cyclase catalytic domain |
| 9 | PF00672.27 | 1.0 | 2 | 1992.0 | opposite-strand | HAMP domain |
| 10 | PF00294.26 | 1.0 | 2 | 4665.0 | same-strand | pfkB family carbohydrate kinase |
| 11 | PF04191.15 | 1.0 | 2 | 5793.0 | same-strand | Phospholipid methyltransferase |
| 12 | PF04140.16 | 1.0 | 2 | 5793.0 | same-strand | Isoprenylcysteine carboxyl methyltransferase (ICMT) family |
++ More..