Result : EXP01951
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01951 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 2684487 |
| Right | 2684588 |
| Strand | + |
| Nucleotide Sequence | GTGACCGCCGCCAAGAACCCGCGCCCCGATCTGCGAATCGCGCTGGTGGCTCGGCGGCACATCGACCTCAAGCGGGTCTGCAGCTGTGGCTGTCGGCCTTGA |
| Sequence | VTAAKNPRPDLRIALVARRHIDLKRVCSCGCRP |
| Source of smORF | Transcriptional-level |
| Function | It is a leaderless short ORF in mycobacteria. Encodes a polycysteine tract which makes it a cysteine-responsive regulator of operonic gene expression. Pubmed:32181921 |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Manually curated function from literature |
| Uniprot ID | |
| ORF Length (Amino Acid) | 33 |
++ More..
| Conservation Analysis |
No. of Species: 43
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2742824 | 2742925 | + | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 2 | 2684487 | 2684588 | + | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
| 3 | 2792727 | 2792831 | + | NZ_CP011883.2 | Mycobacterium haemophilum DSM 44634 |
| 4 | 3848753 | 3848857 | - | NZ_AP022615.1 | Mycobacterium heidelbergense |
| 5 | 5819999 | 5820091 | - | NZ_AP022587.1 | Mycobacterium stomatepiae |
| 6 | 4520171 | 4520263 | - | NZ_AP022568.1 | Mycobacterium simiae |
| 7 | 67284 | 67379 | - | NZ_AP022565.1 | Mycolicibacterium alvei |
| 8 | 3823629 | 3823733 | + | NZ_AP022613.1 | Mycobacterium conspicuum |
| 9 | 4827130 | 4827225 | + | NZ_CP043474.1 | Mycobacterium grossiae |
| 10 | 3834342 | 3834437 | + | NZ_AP022610.1 | Mycolicibacterium madagascariense |
| 11 | 5838015 | 5838104 | + | NZ_CP058277.1 | Mycobacterium marinum |
| 12 | 1500915 | 1501007 | + | NZ_AP022569.1 | Mycobacterium cookii |
| 13 | 4587441 | 4587533 | + | NZ_CP025546.1 | Mycobacterium paragordonae |
| 14 | 1556931 | 1557026 | - | NZ_AP022612.1 | Mycolicibacterium confluentis |
| 15 | 2583764 | 2583859 | + | NZ_AP022605.1 | Mycobacterium doricum |
| 16 | 3126282 | 3126371 | - | NZ_AP022572.1 | Mycobacterium shottsii |
| 17 | 4097646 | 4097735 | + | NZ_AP018410.1 | Mycobacterium pseudoshottsii JCM 15466 |
| 18 | 847745 | 847840 | - | NZ_AP022586.1 | Mycolicibacterium litorale |
| 19 | 3833048 | 3833140 | + | NZ_CP011491.1 | Mycolicibacterium vaccae 95051 |
| 20 | 2976527 | 2976619 | + | NZ_LT906483.1 | Mycolicibacterium thermoresistibile |
| 21 | 4521147 | 4521239 | + | NZ_AP022595.1 | Mycolicibacterium sarraceniae |
| 22 | 3626489 | 3626581 | + | NZ_AP022561.1 | Mycolicibacterium aichiense |
| 23 | 6125273 | 6125356 | + | NZ_AP022600.1 | Mycolicibacterium tokaiense |
| 24 | 1146401 | 1146496 | - | NZ_AP022617.1 | Mycolicibacterium monacense |
| 25 | 111348 | 111440 | + | NZ_AP022596.1 | Mycolicibacterium helvum |
| 26 | 7502707 | 7502799 | + | NZ_CP042266.1 | Streptomyces qinzhouensis |
| 27 | 7091738 | 7091830 | - | NZ_CP020700.1 | Streptomyces tsukubensis |
| 28 | 4217846 | 4217938 | - | NZ_CP020570.1 | Streptomyces violaceoruber |
| 29 | 4178328 | 4178420 | - | NZ_CP070242.1 | Streptomyces californicus |
| 30 | 4541935 | 4542027 | - | NC_010572.1 | Streptomyces griseus subsp. griseus NBRC 13350 |
| 31 | 1200872 | 1200988 | - | NC_010572.1 | Streptomyces griseus subsp. griseus NBRC 13350 |
| 32 | 3502126 | 3502221 | - | NZ_AP022598.1 | Mycolicibacterium parafortuitum |
| 33 | 209865 | 209957 | - | NZ_CP051486.1 | Streptomyces pratensis |
| 34 | 6831556 | 6831648 | - | NZ_CP031742.1 | Streptomyces koyangensis |
| 35 | 7276359 | 7276457 | + | NC_021177.1 | Streptomyces fulvissimus DSM 40593 |
| 36 | 3943252 | 3943347 | - | NZ_CP023692.1 | Streptomyces vinaceus |
| 37 | 5273759 | 5273860 | - | NZ_CP023699.1 | Streptomyces kanamyceticus |
| 38 | 7738460 | 7738552 | - | NC_014666.1 | Frankia inefficax |
| 39 | 4061617 | 4061712 | - | NZ_CP023701.1 | Streptomyces subrutilus |
| 40 | 4388714 | 4388818 | - | NZ_CP020569.1 | Streptomyces gilvosporeus |
| 41 | 4520509 | 4520604 | + | NZ_CP071139.1 | Streptomyces nojiriensis |
| 42 | 5419690 | 5419791 | + | NZ_CP023694.1 | Streptomyces coeruleorubidus |
| 43 | 3982798 | 3982902 | - | NZ_CP019457.1 | Streptomyces lydicus |
| 44 | 8759491 | 8759589 | + | NZ_CP022744.1 | Streptomyces lincolnensis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015848.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF04055.23 | 0.67 | 29 | 140 | opposite-strand | Radical SAM superfamily |
| 2 | PF01077.24 | 0.63 | 27 | 118 | same-strand | Nitrite and sulphite reductase 4Fe-4S domain |
| 3 | PF03460.19 | 0.63 | 27 | 118 | same-strand | Nitrite/Sulfite reductase ferredoxin-like half domain |
| 4 | PF01507.21 | 0.6 | 26 | 1789.0 | same-strand | Phosphoadenosine phosphosulfate reductase family |
| 5 | PF01903.19 | 0.63 | 27 | 2534 | same-strand | CbiX |
++ More..