Result : EXP01950

Protein Information

• Protein name: EXP01950
• NCBI Accession ID: NC_000962.3
• Organism: Mycobacterium tuberculosis H37Rv
• Left: 2655221
• Right: 2655268
• Strand: +
• Nucleotide Sequence: ATGATCTCGTCGGGCTTCAGCCACTCGGTAGGGAAGATCCGCCAATGA
• Sequence: MISSGFSHSVGKIRQ
• Source of smORF: Transcriptional-level
• Function: It is a short ORF coupled to a downstream gene whose start codon overlaps the stop codon of this ORF. This indicates that this smORF might be translationally coupled to downstream gene. Pubmed:26536359
• Pubmed ID: 26536359
• Functional Category: Manually curated function from literature
• ORF Length (Amino Acid): 15

Conservation Analysis

No. of Species: 2

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	2713834	2713881	+	NC_015848.1	Mycobacterium canettii CIPT 140010059
2	2655221	2655268	+	NC_000962.3	Mycobacterium tuberculosis H37Rv

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NC_015848.1

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF04452.16	1.0	2	2396.0	opposite-strand	RNA methyltransferase
2	PF01556.20	1.0	2	1234.0	opposite-strand	DnaJ C terminal domain
3	PF00226.33	1.0	2	1234.0	opposite-strand	DnaJ domain
4	PF00684.21	1.0	2	1234.0	opposite-strand	DnaJ central domain
5	PF01628.23	1.0	2	128.0	opposite-strand	HrcA protein C terminal domain
6	PF03621.15	1.0	2	947.0	opposite-strand	MbtH-like protein
7	PF00501.30	1.0	2	2432.0	opposite-strand	AMP-binding enzyme
8	PF00668.22	1.0	2	2432.0	opposite-strand	Condensation domain
9	PF13193.8	1.0	2	2432.0	opposite-strand	AMP-binding enzyme C-terminal domain
10	PF00550.27	1.0	2	2432.0	opposite-strand	Phosphopantetheine attachment site