Result : EXP01948

Protein Information

• Protein name: EXP01948
• NCBI Accession ID: NC_000962.3
• Organism: Mycobacterium tuberculosis H37Rv
• Left: 2637471
• Right: 2637560
• Strand: +
• Nucleotide Sequence: GTGACCGTTGCGACCGTGCGATGTGCCCGACGCTCGATGCGCACCAATTCGAACCAACTCAGGTCTTACGCTGCCTGGACGCCGAACTAG
• Sequence: VTVATVRCARRSMRTNSNQLRSYAAWTPN
• Source of smORF: Transcriptional-level
• Pubmed ID: 26536359
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 29

Conservation Analysis

No. of Species: 3

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	2637471	2637560	+	NC_000962.3	Mycobacterium tuberculosis H37Rv
2	2696084	2696173	+	NC_015848.1	Mycobacterium canettii CIPT 140010059
3	2890642	2890728	-	NZ_CP023563.1	Brachybacterium vulturis

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NC_000962.3

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF00823.21	0.67	2	1622.5	opposite-strand	PPE family
2	PF12484.10	0.67	2	3280	opposite-strand	PPE-SVP subfamily C-terminal region
3	PF01469.20	0.67	2	324.0	opposite-strand	Pentapeptide repeats (8 copies)
4	PF03129.22	0.67	2	2113.0	opposite-strand	Anticodon binding domain
5	PF01022.22	0.67	2	3686.0	same-strand	Bacterial regulatory protein, arsR family
6	PF12840.9	0.67	2	3686.0	same-strand	Helix-turn-helix domain
7	PF01475.21	0.67	2	4090.0	same-strand	Ferric uptake regulator family