Result : EXP01947
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01947 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 2628046 |
| Right | 2628099 |
| Strand | + |
| Nucleotide Sequence | GTGAAGGTCAACTTCGGCTGGATGGCGGGTTCGACGATCTGCGGCCCACCTTGA |
| Sequence | VKVNFGWMAGSTICGPP |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 17 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2685149 | 2685202 | + | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 2 | 2628046 | 2628099 | + | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015848.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF04536.16 | 1.0 | 2 | 2243.0 | same-strand | TPM domain |
| 2 | PF06013.14 | 1.0 | 2 | 1874 | opposite-strand | Proteins of 100 residues with WXG |
| 3 | PF04185.16 | 1.0 | 2 | 682.0 | opposite-strand | Phosphoesterase family |
| 4 | PF00823.21 | 1.0 | 2 | 4824.5 | opposite-strand | PPE family |
| 5 | PF12484.10 | 1.0 | 2 | 4824.5 | opposite-strand | PPE-SVP subfamily C-terminal region |
++ More..