Protein Information |
Information Type | Description |
---|---|
Protein name | EXP01946 |
NCBI Accession ID | NC_000962.3 |
Organism | Mycobacterium tuberculosis H37Rv |
Left | 2608526 |
Right | 2608594 |
Strand | + |
Nucleotide Sequence | ATGCAACAGGCCATACAGCTGCGCTTTATCCTCCCGCGCCGCCTCGCCGTGGGCTGTTGTTGTTGTTGA |
Sequence | MQQAIQLRFILPRRLAVGCCCC |
Source of smORF | Transcriptional-level |
Function | It is a leaderless short ORF in mycobacteria. Encodes a polycysteine tract which makes it a cysteine-responsive regulator of operonic gene expression. Pubmed:32181921 |
Pubmed ID | 26536359 |
Domain | |
Functional Category | Manually curated function from literature |
Uniprot ID | |
ORF Length (Amino Acid) | 22 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 2665631 | 2665699 | + | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
2 | 2608526 | 2608594 | + | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
3 | 673011 | 673085 | - | NZ_AP022614.1 | Mycobacterium parmense |
4 | 1007002 | 1007070 | - | NZ_AP022575.1 | Mycobacterium shinjukuense |
5 | 2553939 | 2554004 | + | NZ_AP022581.1 | Mycobacterium lacus |
6 | 1861850 | 1861915 | - | NZ_CP023147.1 | Mycobacterium marseillense |
7 | 5655303 | 5655374 | - | NZ_AP022576.1 | Mycobacterium florentinum |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF00291.27 | 1.0 | 7 | 1321 | same-strand | Pyridoxal-phosphate dependent enzyme |
2 | PF00132.26 | 1.0 | 7 | 2256 | same-strand | Bacterial transferase hexapeptide (six repeats) |
3 | PF14602.8 | 1.0 | 7 | 2256 | same-strand | Hexapeptide repeat of succinyl-transferase |