Result : EXP01944
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01944 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 2596027 |
| Right | 2596173 |
| Strand | + |
| Nucleotide Sequence | GTGGAGGTGCTCCCACTGTGCTTGCGCGACTTGGACGTCGACTGGCGCGGTGACGTCCATCCAGGGGTTGATCGCGTATGCGACGGCAAAGAAGGCCGGCGGGGTCATTGCATACCGCCGCGTCCGGGGGGTGCGGCGTGCAGGTGA |
| Sequence | VEVLPLCLRDLDVDWRGDVHPGVDRVCDGKEGRRGHCIPPRPGGAACR |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 48 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2653131 | 2653277 | + | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 2 | 2596027 | 2596173 | + | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
| 3 | 2279156 | 2279287 | + | NZ_AP022582.1 | Mycobacterium seoulense |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015848.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00582.28 | 1.0 | 3 | 3301 | opposite-strand | Universal stress protein family |
| 2 | PF13520.8 | 1.0 | 3 | 1907 | opposite-strand | Amino acid permease |
| 3 | PF00324.23 | 1.0 | 3 | 1907 | opposite-strand | Amino acid permease |
| 4 | PF13906.8 | 1.0 | 3 | 1907 | opposite-strand | C-terminus of AA permease |
| 5 | PF19420.1 | 0.67 | 2 | -107.0 | opposite-strand | N,N dimethylarginine dimethylhydrolase, eukaryotic |
| 6 | PF13404.8 | 1.0 | 3 | 161 | same-strand | AsnC-type helix-turn-helix domain |
| 7 | PF01037.23 | 1.0 | 3 | 161 | same-strand | Lrp/AsnC ligand binding domain |
| 8 | PF13412.8 | 1.0 | 3 | 161 | same-strand | Winged helix-turn-helix DNA-binding |
| 9 | PF02361.18 | 1.0 | 3 | 836 | opposite-strand | Cobalt transport protein |
| 10 | PF00005.29 | 1.0 | 3 | 1681 | opposite-strand | ABC transporter |
| 11 | PF01047.24 | 0.67 | 2 | 3815.0 | same-strand | MarR family |
| 12 | PF12802.9 | 0.67 | 2 | 3815.0 | same-strand | MarR family |
| 13 | PF13463.8 | 0.67 | 2 | 3815.0 | same-strand | Winged helix DNA-binding domain |
| 14 | PF00934.22 | 0.67 | 2 | 4558.0 | same-strand | PE family |
++ More..