Result : EXP01941
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01941 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 2401939 |
| Right | 2402016 |
| Strand | + |
| Nucleotide Sequence | GTGCGGGGCAATCCGATAGCCTTAGCTGCCAGCCCCGGTGGTTGGTTGGTCCGAGTGGCGGAATGGCAGACGCGCTAG |
| Sequence | VRGNPIALAASPGGWLVRVAEWQTR |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 25 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2455978 | 2456055 | + | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 2 | 2401939 | 2402016 | + | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
| 3 | 1020120 | 1020185 | - | NZ_AP022563.1 | Mycolicibacterium duvalii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015848.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF18963.2 | 1.0 | 3 | 3255 | same-strand | Family of unknown function (DUF5703) |
| 2 | PF01180.23 | 1.0 | 3 | 2146 | same-strand | Dihydroorotate dehydrogenase |
| 3 | PF01161.22 | 1.0 | 3 | 1611 | opposite-strand | Phosphatidylethanolamine-binding protein |
| 4 | PF01546.30 | 1.0 | 3 | 217 | opposite-strand | Peptidase family M20/M25/M40 |
| 5 | PF07687.16 | 0.67 | 2 | 304.0 | opposite-strand | Peptidase dimerisation domain |
| 6 | PF05016.17 | 0.67 | 2 | 177.0 | opposite-strand | ParE toxin of type II toxin-antitoxin system, parDE |
| 7 | PF00156.29 | 0.67 | 2 | 1147.0 | same-strand | Phosphoribosyl transferase domain |
++ More..