Result : EXP01939
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01939 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 2231652 |
| Right | 2231732 |
| Strand | + |
| Nucleotide Sequence | GTGGGCATCTACGCAGTGACGGTACGTCGTGTCCGCCCTCGGACGGTCGCGACGGGCATGGGGCTGGCACCGGCTCCATGA |
| Sequence | VGIYAVTVRRVRPRTVATGMGLAPAP |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 26 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2280155 | 2280235 | + | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 2 | 2231652 | 2231732 | + | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015848.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01083.24 | 1.0 | 2 | 3091.0 | opposite-strand | Cutinase |
| 2 | PF02594.18 | 1.0 | 2 | 2746.0 | same-strand | Uncharacterised ACR, YggU family COG1872 |
| 3 | PF00126.29 | 1.0 | 2 | 1750.0 | opposite-strand | Bacterial regulatory helix-turn-helix protein, lysR family |
| 4 | PF03466.22 | 1.0 | 2 | 1750.0 | opposite-strand | LysR substrate binding domain |
| 5 | PF01810.20 | 1.0 | 2 | 1042.0 | same-strand | LysE type translocator |
++ More..