Result : EXP01937
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01937 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 2104903 |
| Right | 2104968 |
| Strand | + |
| Nucleotide Sequence | ATGTTACTGGACAGTAGCTATTCGGGGAAACTCCGCACCGCCACGACGCGCAGACGATCTTGGTAA |
| Sequence | MLLDSSYSGKLRTATTRRRSW |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 21 |
++ More..
| Conservation Analysis |
No. of Species: 4
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2143401 | 2143466 | + | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 2 | 2104903 | 2104968 | + | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
| 3 | 2865897 | 2865962 | + | NZ_LR130759.1 | Mycobacterium basiliense |
| 4 | 3469959 | 3470012 | + | NZ_CP025546.1 | Mycobacterium paragordonae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015848.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF02492.21 | 1.0 | 4 | 3889.0 | same-strand | CobW/HypB/UreG, nucleotide-binding domain |
| 2 | PF07992.16 | 1.0 | 4 | 1861.0 | opposite-strand | Pyridine nucleotide-disulphide oxidoreductase |
| 3 | PF00070.29 | 1.0 | 4 | 1861.0 | opposite-strand | Pyridine nucleotide-disulphide oxidoreductase |
| 4 | PF13561.8 | 1.0 | 4 | 86.0 | opposite-strand | Enoyl-(Acyl carrier protein) reductase |
| 5 | PF00106.27 | 1.0 | 4 | 86.0 | opposite-strand | short chain dehydrogenase |
| 6 | PF13531.8 | 1.0 | 4 | 53.0 | same-strand | Bacterial extracellular solute-binding protein |
| 7 | PF00528.24 | 1.0 | 4 | 814.5 | same-strand | Binding-protein-dependent transport system inner membrane component |
| 8 | PF00005.29 | 1.0 | 4 | 1615.5 | same-strand | ABC transporter |
| 9 | PF03459.19 | 1.0 | 4 | 1615.5 | same-strand | TOBE domain |
| 10 | PF07174.13 | 1.0 | 4 | 2781.0 | same-strand | Fibronectin-attachment protein (FAP) |
| 11 | PF04226.15 | 1.0 | 4 | 4197.0 | same-strand | Transglycosylase associated protein |
++ More..