Result : EXP01934
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01934 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 2002618 |
| Right | 2002671 |
| Strand | + |
| Nucleotide Sequence | GTGGCGGCGTGCATGAGGTGGCTGCTCGTGAGCAACGTTCGGACGGGCCGATGA |
| Sequence | VAACMRWLLVSNVRTGR |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 17 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2045567 | 2045620 | + | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 2 | 2002618 | 2002671 | + | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015848.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF02720.19 | 1.0 | 2 | 4111.5 | opposite-strand | Domain of unknown function (DUF222) |
| 2 | PF01844.25 | 1.0 | 2 | 4111.5 | opposite-strand | HNH endonuclease |
| 3 | PF02583.19 | 1.0 | 2 | 2621.0 | same-strand | Metal-sensitive transcriptional repressor |
| 4 | PF02627.22 | 1.0 | 2 | 2194.0 | same-strand | Carboxymuconolactone decarboxylase family |
| 5 | PF00934.22 | 1.0 | 2 | 148.0 | same-strand | PE family |
| 6 | PF01168.22 | 1.0 | 2 | -3.0 | same-strand | Alanine racemase, N-terminal domain |
| 7 | PF04389.19 | 1.0 | 2 | 1288.0 | same-strand | Peptidase family M28 |
| 8 | PF04030.16 | 1.0 | 2 | 2490.0 | same-strand | D-arabinono-1,4-lactone oxidase |
| 9 | PF01565.25 | 1.0 | 2 | 2490.0 | same-strand | FAD binding domain |
| 10 | PF03861.16 | 1.0 | 2 | 3992.0 | same-strand | ANTAR domain |
++ More..