Protein Information |
Information Type | Description |
---|---|
Protein name | EXP01931 |
NCBI Accession ID | NC_000962.3 |
Organism | Mycobacterium tuberculosis H37Rv |
Left | 1947760 |
Right | 1947864 |
Strand | + |
Nucleotide Sequence | ATGCAACCATGTGAGCTCACCGCCGTCGCGCTGACCGCAACGCCCCCGCCCGCGCCTCCGTCCCTGCGCCGGGCACCGGCGTCGACGTCACCGCGGCTGGCGTGA |
Sequence | MQPCELTAVALTATPPPAPPSLRRAPASTSPRLA |
Source of smORF | Transcriptional-level |
Function | It is a short ORF coupled to a downstream gene whose start codon overlaps the stop codon of this ORF. This indicates that this smORF might be translationally coupled to downstream gene. Pubmed:26536359 |
Pubmed ID | 26536359 |
Domain | |
Functional Category | Manually curated function from literature |
Uniprot ID | |
ORF Length (Amino Acid) | 34 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 1947760 | 1947864 | + | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
2 | 1977073 | 1977177 | + | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
3 | 4369101 | 4369187 | + | NZ_AP022615.1 | Mycobacterium heidelbergense |
4 | 5471519 | 5471626 | - | NZ_CP058277.1 | Mycobacterium marinum |
5 | 3735739 | 3735846 | - | NZ_AP018410.1 | Mycobacterium pseudoshottsii JCM 15466 |
6 | 1464189 | 1464293 | - | NZ_AP022590.1 | Mycobacterium mantenii |
7 | 4639796 | 4639903 | - | NZ_AP022572.1 | Mycobacterium shottsii |
8 | 3119695 | 3119787 | + | NZ_LS483470.1 | Leminorella richardii |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF00144.26 | 0.88 | 7 | 1472 | same-strand | Beta-lactamase |