Result : EXP01930
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01930 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 1907466 |
| Right | 1907525 |
| Strand | + |
| Nucleotide Sequence | GTGACGATGCGGGCCGGTGTGGTCCGAGGAGGAGCCCGACAATTTAAGCTAGTCGGGTGA |
| Sequence | VTMRAGVVRGGARQFKLVG |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 19 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1935546 | 1935605 | + | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 2 | 1907466 | 1907525 | + | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015848.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00441.26 | 1.0 | 2 | 3046.0 | same-strand | Acyl-CoA dehydrogenase, C-terminal domain |
| 2 | PF02770.21 | 1.0 | 2 | 3046.0 | same-strand | Acyl-CoA dehydrogenase, middle domain |
| 3 | PF08028.13 | 1.0 | 2 | 3046.0 | same-strand | Acyl-CoA dehydrogenase, C-terminal domain |
| 4 | PF12974.9 | 1.0 | 2 | 2213.0 | same-strand | ABC transporter, phosphonate, periplasmic substrate-binding protein |
| 5 | PF04055.23 | 1.0 | 2 | 1224.0 | same-strand | Radical SAM superfamily |
| 6 | PF05103.15 | 1.0 | 2 | 146.0 | same-strand | DivIVA protein |
| 7 | PF00501.30 | 1.0 | 2 | 72.0 | same-strand | AMP-binding enzyme |
| 8 | PF12697.9 | 1.0 | 2 | 72.0 | same-strand | Alpha/beta hydrolase family |
| 9 | PF03966.18 | 1.0 | 2 | 3061.0 | same-strand | Trm112p-like protein |
| 10 | PF17920.3 | 1.0 | 2 | 3251.0 | opposite-strand | Tetracyclin repressor-like, C-terminal domain |
| 11 | PF00440.25 | 1.0 | 2 | 3251.0 | opposite-strand | Bacterial regulatory proteins, tetR family |
| 12 | PF01061.26 | 1.0 | 2 | 3876.0 | opposite-strand | ABC-2 type transporter |
| 13 | PF00005.29 | 1.0 | 2 | 4628.0 | opposite-strand | ABC transporter |
++ More..