Result : EXP01928
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01928 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 1753565 |
| Right | 1753609 |
| Strand | + |
| Nucleotide Sequence | GTGACCTGGGCCATACTGATCCGCTGTCAAGGAGAACGGAAATGA |
| Sequence | VTWAILIRCQGERK |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 14 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1753565 | 1753609 | + | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
| 2 | 1785853 | 1785897 | + | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000962.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00106.27 | 1.0 | 2 | 6730.0 | same-strand | short chain dehydrogenase |
| 2 | PF13561.8 | 1.0 | 2 | 6730.0 | same-strand | Enoyl-(Acyl carrier protein) reductase |
| 3 | PF08659.12 | 1.0 | 2 | 6730.0 | same-strand | KR domain |
| 4 | PF10604.11 | 1.0 | 2 | 5940.0 | same-strand | Polyketide cyclase / dehydrase and lipid transport |
| 5 | PF07733.14 | 1.0 | 2 | 2318.0 | same-strand | Bacterial DNA polymerase III alpha NTPase domain |
| 6 | PF17657.3 | 1.0 | 2 | 2318.0 | same-strand | Bacterial DNA polymerase III alpha subunit finger domain |
| 7 | PF02811.21 | 1.0 | 2 | 2318.0 | same-strand | PHP domain |
| 8 | PF14579.8 | 1.0 | 2 | 2318.0 | same-strand | Helix-hairpin-helix motif |
| 9 | PF01336.27 | 1.0 | 2 | 2318.0 | same-strand | OB-fold nucleic acid binding domain |
| 10 | PF01469.20 | 1.0 | 2 | 233.0 | opposite-strand | Pentapeptide repeats (8 copies) |
| 11 | PF00823.21 | 1.0 | 2 | 233.0 | opposite-strand | PPE family |
| 12 | PF19277.1 | 1.0 | 2 | 1837.0 | same-strand | Glycerol-3-phosphate acyltransferase C-terminal region |
| 13 | PF01553.23 | 1.0 | 2 | 1837.0 | same-strand | Acyltransferase |
| 14 | PF00890.26 | 1.0 | 2 | 4073.0 | same-strand | FAD binding domain |
| 15 | PF02910.22 | 1.0 | 2 | 4073.0 | same-strand | Fumarate reductase flavoprotein C-term |
++ More..