Result : EXP01927
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01927 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 1745018 |
| Right | 1745077 |
| Strand | + |
| Nucleotide Sequence | ATGACCCGTGTCCATCACCCCACGCCGCCATCAGGAGCTACCCACGATGAATCTTGGTGA |
| Sequence | MTRVHHPTPPSGATHDESW |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 19 |
++ More..
| Conservation Analysis |
No. of Species: 4
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1777182 | 1777241 | + | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 2 | 1745018 | 1745077 | + | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
| 3 | 6092828 | 6092887 | + | NC_022663.1 | Mycobacterium kansasii ATCC 12478 |
| 4 | 2469584 | 2469643 | + | NZ_LR130759.1 | Mycobacterium basiliense |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015848.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00710.22 | 0.75 | 3 | 2841 | opposite-strand | Asparaginase, N-terminal |
| 2 | PF17763.3 | 0.75 | 3 | 2841 | opposite-strand | Glutaminase/Asparaginase C-terminal domain |
| 3 | PF01252.20 | 1.0 | 4 | 2224.0 | same-strand | Signal peptidase (SPase) II |
| 4 | PF00849.24 | 1.0 | 4 | 1301.5 | same-strand | RNA pseudouridylate synthase |
| 5 | PF09864.11 | 0.75 | 3 | 647 | opposite-strand | Membrane-bound lysozyme-inhibitor of c-type lysozyme |
| 6 | PF07007.14 | 0.75 | 3 | 647 | opposite-strand | Lysozyme inhibitor LprI |
| 7 | PF01152.23 | 1.0 | 4 | 182.0 | opposite-strand | Bacterial-like globin |
| 8 | PF00106.27 | 1.0 | 4 | 497.5 | same-strand | short chain dehydrogenase |
| 9 | PF08659.12 | 1.0 | 4 | 497.5 | same-strand | KR domain |
| 10 | PF13561.8 | 1.0 | 4 | 1012.5 | same-strand | Enoyl-(Acyl carrier protein) reductase |
| 11 | PF10604.11 | 1.0 | 4 | 2179.0 | same-strand | Polyketide cyclase / dehydrase and lipid transport |
| 12 | PF07733.14 | 1.0 | 4 | 2678.0 | same-strand | Bacterial DNA polymerase III alpha NTPase domain |
| 13 | PF17657.3 | 1.0 | 4 | 2678.0 | same-strand | Bacterial DNA polymerase III alpha subunit finger domain |
| 14 | PF02811.21 | 1.0 | 4 | 2678.0 | same-strand | PHP domain |
| 15 | PF14579.8 | 1.0 | 4 | 2678.0 | same-strand | Helix-hairpin-helix motif |
| 16 | PF01336.27 | 1.0 | 4 | 2678.0 | same-strand | OB-fold nucleic acid binding domain |
++ More..