Protein Information |
Information Type | Description |
---|---|
Protein name | EXP01927 |
NCBI Accession ID | NC_000962.3 |
Organism | Mycobacterium tuberculosis H37Rv |
Left | 1745018 |
Right | 1745077 |
Strand | + |
Nucleotide Sequence | ATGACCCGTGTCCATCACCCCACGCCGCCATCAGGAGCTACCCACGATGAATCTTGGTGA |
Sequence | MTRVHHPTPPSGATHDESW |
Source of smORF | Transcriptional-level |
Function | |
Pubmed ID | 26536359 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 19 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 1777182 | 1777241 | + | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
2 | 1745018 | 1745077 | + | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
3 | 6092828 | 6092887 | + | NC_022663.1 | Mycobacterium kansasii ATCC 12478 |
4 | 2469584 | 2469643 | + | NZ_LR130759.1 | Mycobacterium basiliense |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF00710.22 | 0.75 | 3 | 2841 | opposite-strand | Asparaginase, N-terminal |
2 | PF17763.3 | 0.75 | 3 | 2841 | opposite-strand | Glutaminase/Asparaginase C-terminal domain |
3 | PF01252.20 | 1.0 | 4 | 2224.0 | same-strand | Signal peptidase (SPase) II |
4 | PF00849.24 | 1.0 | 4 | 1301.5 | same-strand | RNA pseudouridylate synthase |
5 | PF09864.11 | 0.75 | 3 | 647 | opposite-strand | Membrane-bound lysozyme-inhibitor of c-type lysozyme |
6 | PF07007.14 | 0.75 | 3 | 647 | opposite-strand | Lysozyme inhibitor LprI |
7 | PF01152.23 | 1.0 | 4 | 182.0 | opposite-strand | Bacterial-like globin |
8 | PF00106.27 | 1.0 | 4 | 497.5 | same-strand | short chain dehydrogenase |
9 | PF08659.12 | 1.0 | 4 | 497.5 | same-strand | KR domain |
10 | PF13561.8 | 1.0 | 4 | 1012.5 | same-strand | Enoyl-(Acyl carrier protein) reductase |
11 | PF10604.11 | 1.0 | 4 | 2179.0 | same-strand | Polyketide cyclase / dehydrase and lipid transport |
12 | PF07733.14 | 1.0 | 4 | 2678.0 | same-strand | Bacterial DNA polymerase III alpha NTPase domain |
13 | PF17657.3 | 1.0 | 4 | 2678.0 | same-strand | Bacterial DNA polymerase III alpha subunit finger domain |
14 | PF02811.21 | 1.0 | 4 | 2678.0 | same-strand | PHP domain |
15 | PF14579.8 | 1.0 | 4 | 2678.0 | same-strand | Helix-hairpin-helix motif |
16 | PF01336.27 | 1.0 | 4 | 2678.0 | same-strand | OB-fold nucleic acid binding domain |