Result : EXP01925
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01925 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 1568170 |
| Right | 1568214 |
| Strand | + |
| Nucleotide Sequence | GTGGTGGTCGGGCGCAACGGGACGTCACCGTTCTTGTCGAAGTAA |
| Sequence | VVVGRNGTSPFLSK |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 14 |
++ More..
| Conservation Analysis |
No. of Species: 37
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 5847596 | 5847643 | + | NC_022663.1 | Mycobacterium kansasii ATCC 12478 |
| 2 | 1306336 | 1306377 | + | NZ_AP022581.1 | Mycobacterium lacus |
| 3 | 1198607 | 1198651 | - | NZ_AP018165.1 | [Mycobacterium] stephanolepidis |
| 4 | 3843583 | 3843627 | + | NZ_AP022583.1 | Mycobacterium noviomagense |
| 5 | 2505640 | 2505681 | - | NC_015576.1 | Mycolicibacter sinensis |
| 6 | 2061331 | 2061375 | - | NZ_AP022575.1 | Mycobacterium shinjukuense |
| 7 | 1591511 | 1591555 | + | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 8 | 3941036 | 3941077 | + | NZ_AP022562.1 | Mycobacterium novum |
| 9 | 1568170 | 1568214 | + | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
| 10 | 2690076 | 2690120 | + | NZ_AP022610.1 | Mycolicibacterium madagascariense |
| 11 | 1335196 | 1335237 | - | NZ_CP007220.1 | Mycobacteroides chelonae CCUG 47445 |
| 12 | 2679509 | 2679550 | + | NZ_CP025546.1 | Mycobacterium paragordonae |
| 13 | 3989859 | 3989903 | + | NZ_CP058277.1 | Mycobacterium marinum |
| 14 | 2161790 | 2161834 | + | NZ_AP022613.1 | Mycobacterium conspicuum |
| 15 | 2400855 | 2400899 | + | NZ_AP018410.1 | Mycobacterium pseudoshottsii JCM 15466 |
| 16 | 3349803 | 3349844 | + | NZ_AP022572.1 | Mycobacterium shottsii |
| 17 | 839871 | 839915 | + | NZ_AP022582.1 | Mycobacterium seoulense |
| 18 | 4472322 | 4472366 | - | NZ_AP022606.1 | Mycobacterium branderi |
| 19 | 77575 | 77619 | - | NZ_AP022615.1 | Mycobacterium heidelbergense |
| 20 | 2407807 | 2407851 | - | NZ_LT906469.1 | Mycolicibacter terrae |
| 21 | 164048 | 164092 | + | NZ_AP022619.1 | Mycobacterium paraseoulense |
| 22 | 1256936 | 1256980 | - | NZ_AP022576.1 | Mycobacterium florentinum |
| 23 | 2708177 | 2708221 | + | NZ_CP062008.1 | Mycolicibacterium mucogenicum DSM 44124 |
| 24 | 274519 | 274563 | + | NZ_AP022577.1 | Mycolicibacterium aubagnense |
| 25 | 159512 | 159553 | + | NZ_AP022573.1 | Mycobacterium saskatchewanense |
| 26 | 1019155 | 1019199 | - | NZ_AP022616.1 | Mycolicibacterium phocaicum |
| 27 | 1878423 | 1878467 | - | NZ_AP022609.1 | Mycolicibacter hiberniae |
| 28 | 6651609 | 6651653 | - | NZ_AP023396.1 | Nocardia wallacei |
| 29 | 5085409 | 5085453 | + | NZ_AP022596.1 | Mycolicibacterium helvum |
| 30 | 590593 | 590637 | + | NZ_AP022590.1 | Mycobacterium mantenii |
| 31 | 3597624 | 3597668 | - | NC_016948.1 | Mycobacterium paraintracellulare |
| 32 | 3477480 | 3477524 | - | NC_016946.1 | Mycobacterium intracellulare ATCC 13950 |
| 33 | 3298097 | 3298141 | - | NZ_CP023147.1 | Mycobacterium marseillense |
| 34 | 1137891 | 1137932 | + | NC_006361.1 | Nocardia farcinica IFM 10152 |
| 35 | 5213061 | 5213105 | - | NZ_AP022614.1 | Mycobacterium parmense |
| 36 | 4004082 | 4004126 | - | NZ_AP022605.1 | Mycobacterium doricum |
| 37 | 5167524 | 5167568 | - | NZ_CP022088.2 | Nocardia brasiliensis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_022663.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01192.24 | 0.62 | 23 | 3275 | same-strand | RNA polymerase Rpb6 |
| 2 | PF04127.17 | 0.73 | 27 | 2030 | same-strand | DNA / pantothenate metabolism flavoprotein |
| 3 | PF02441.21 | 0.73 | 27 | 2030 | same-strand | Flavoprotein |
| 4 | PF02773.18 | 0.81 | 30 | 668.0 | same-strand | S-adenosylmethionine synthetase, C-terminal domain |
| 5 | PF02772.18 | 0.81 | 30 | 668.0 | same-strand | S-adenosylmethionine synthetase, central domain |
| 6 | PF00438.22 | 0.81 | 30 | 668.0 | same-strand | S-adenosylmethionine synthetase, N-terminal domain |
| 7 | PF13450.8 | 0.89 | 33 | -44.0 | opposite-strand | NAD(P)-binding Rossmann-like domain |
| 8 | PF07859.15 | 0.73 | 27 | 1554 | opposite-strand | alpha/beta hydrolase fold |
| 9 | PF07947.16 | 0.65 | 24 | 3359.0 | same-strand | YhhN family |
++ More..