Result : EXP01924
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01924 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 1564978 |
| Right | 1565043 |
| Strand | + |
| Nucleotide Sequence | GTGCGGAATTGGTATCCTTGCTGGTGGGAACGGCACCGGGCTCCCCGTGACCCACGTCGTGACTAG |
| Sequence | VRNWYPCWWERHRAPRDPRRD |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 21 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1588319 | 1588384 | + | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 2 | 1564978 | 1565043 | + | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
| 3 | 1225473 | 1225538 | - | NZ_CP012944.1 | Ralstonia solanacearum |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015848.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00215.26 | 0.67 | 2 | 3709.0 | same-strand | Orotidine 5'-phosphate decarboxylase / HUMPS family |
| 2 | PF00934.22 | 0.67 | 2 | 3206.0 | same-strand | PE family |
| 3 | PF00823.21 | 0.67 | 2 | 1590.0 | same-strand | PPE family |
| 4 | PF18878.2 | 0.67 | 2 | 1590.0 | same-strand | PPE-PPW subfamily C-terminal region |
| 5 | PF00625.23 | 0.67 | 2 | -49.0 | same-strand | Guanylate kinase |
| 6 | PF01192.24 | 0.67 | 2 | 50.0 | same-strand | RNA polymerase Rpb6 |
| 7 | PF04127.17 | 0.67 | 2 | 398.0 | same-strand | DNA / pantothenate metabolism flavoprotein |
| 8 | PF02441.21 | 0.67 | 2 | 398.0 | same-strand | Flavoprotein |
| 9 | PF02773.18 | 0.67 | 2 | 1782.0 | same-strand | S-adenosylmethionine synthetase, C-terminal domain |
| 10 | PF02772.18 | 0.67 | 2 | 1782.0 | same-strand | S-adenosylmethionine synthetase, central domain |
| 11 | PF00438.22 | 0.67 | 2 | 1782.0 | same-strand | S-adenosylmethionine synthetase, N-terminal domain |
| 12 | PF13450.8 | 0.67 | 2 | 3066.0 | opposite-strand | NAD(P)-binding Rossmann-like domain |
| 13 | PF00067.24 | 0.67 | 2 | 4541.0 | opposite-strand | Cytochrome P450 |
++ More..