Result : EXP01923

Protein Information

• Protein name: EXP01923
• NCBI Accession ID: NC_000962.3
• Organism: Mycobacterium tuberculosis H37Rv
• Left: 1457124
• Right: 1457180
• Strand: +
• Nucleotide Sequence: GTGCCGACGTCACCACGCCCCGCCTGCTCCCCGAACTCGACGGACAAGTCGACCTGA
• Sequence: VPTSPRPACSPNSTDKST
• Source of smORF: Transcriptional-level
• Pubmed ID: 26536359
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 18

Conservation Analysis

No. of Species: 2

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	1481591	1481647	+	NC_015848.1	Mycobacterium canettii CIPT 140010059
2	1457124	1457180	+	NC_000962.3	Mycobacterium tuberculosis H37Rv

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NC_015848.1

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF00288.28	1.0	2	4177.0	same-strand	GHMP kinases N terminal domain
2	PF07497.14	1.0	2	2112.0	same-strand	Rho termination factor, RNA-binding domain
3	PF00006.27	1.0	2	2112.0	same-strand	ATP synthase alpha/beta family, nucleotide-binding domain
4	PF07498.14	1.0	2	2112.0	same-strand	Rho termination factor, N-terminal domain
5	PF01197.20	1.0	2	1719.0	same-strand	Ribosomal protein L31
6	PF03462.20	1.0	2	556.0	same-strand	PCRF domain
7	PF00472.22	1.0	2	556.0	same-strand	RF-1 domain
8	PF17827.3	1.0	2	-56.0	same-strand	PrmC N-terminal domain
9	PF01300.20	1.0	2	378.0	same-strand	Telomere recombination
10	PF00953.23	1.0	2	1115.0	same-strand	Glycosyl transferase family 4
11	PF03899.17	1.0	2	2586.0	same-strand	ATP synthase I chain
12	PF00119.22	1.0	2	3064.0	same-strand	ATP synthase A chain
13	PF00137.23	1.0	2	3865.0	same-strand	ATP synthase subunit C