Protein name |
EXP01921 |
NCBI Accession ID |
NC_000962.3 |
Organism |
Mycobacterium tuberculosis H37Rv |
Left |
1386810 |
Right |
1386860 |
Strand |
+ |
Nucleotide Sequence |
GTGCCAACTGCATCTGTCGCGGTGACTATCGGCTCAGACACTTCGGTGTGA |
Sequence |
VPTASVAVTIGSDTSV |
Source of smORF |
Transcriptional-level |
Function |
It is a short ORF coupled to a downstream gene whose start codon overlaps the stop codon of this ORF. This indicates that this smORF might be translationally coupled to downstream gene. Pubmed:26536359 |
Pubmed ID |
26536359
|
Domain |
|
Functional Category |
Manually curated function from literature |
Uniprot ID |
|
ORF Length (Amino Acid) |
16 |