| Protein name |
EXP01921 |
| NCBI Accession ID |
NC_000962.3 |
| Organism |
Mycobacterium tuberculosis H37Rv |
| Left |
1386810 |
| Right |
1386860 |
| Strand |
+ |
| Nucleotide Sequence |
GTGCCAACTGCATCTGTCGCGGTGACTATCGGCTCAGACACTTCGGTGTGA |
| Sequence |
VPTASVAVTIGSDTSV |
| Source of smORF |
Transcriptional-level |
| Function |
It is a short ORF coupled to a downstream gene whose start codon overlaps the stop codon of this ORF. This indicates that this smORF might be translationally coupled to downstream gene. Pubmed:26536359 |
| Pubmed ID |
26536359
|
| Domain |
|
| Functional Category |
Manually curated function from literature |
| Uniprot ID |
|
| ORF Length (Amino Acid) |
16 |