Result : EXP01918
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01918 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 1302855 |
| Right | 1302902 |
| Strand | + |
| Nucleotide Sequence | ATGGCGCCAAGGTTGGCCAGCATCTCACCTGGTGGGGCGTGCGGATGA |
| Sequence | MAPRLASISPGGACG |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 15 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1322970 | 1323017 | + | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 2 | 1302855 | 1302902 | + | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015848.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00934.22 | 1.0 | 2 | 1452.5 | opposite-strand | PE family |
| 2 | PF02585.19 | 1.0 | 2 | 1640.0 | same-strand | GlcNAc-PI de-N-acetylase |
| 3 | PF04055.23 | 1.0 | 2 | 170.0 | same-strand | Radical SAM superfamily |
| 4 | PF00724.22 | 1.0 | 2 | 3269.0 | opposite-strand | NADH:flavin oxidoreductase / NADH oxidase family |
| 5 | PF07992.16 | 1.0 | 2 | 3269.0 | opposite-strand | Pyridine nucleotide-disulphide oxidoreductase |
| 6 | PF00070.29 | 1.0 | 2 | 3269.0 | opposite-strand | Pyridine nucleotide-disulphide oxidoreductase |
| 7 | PF10400.11 | 1.0 | 2 | 5290.0 | opposite-strand | Virulence activator alpha C-term |
| 8 | PF03551.16 | 1.0 | 2 | 5290.0 | opposite-strand | Transcriptional regulator PadR-like family |
| 9 | PF00037.29 | 1.0 | 2 | 6072.0 | same-strand | 4Fe-4S binding domain |
| 10 | PF12838.9 | 1.0 | 2 | 6072.0 | same-strand | 4Fe-4S dicluster domain |
| 11 | PF13187.8 | 1.0 | 2 | 6072.0 | same-strand | 4Fe-4S dicluster domain |
| 12 | PF12800.9 | 1.0 | 2 | 6072.0 | same-strand | 4Fe-4S binding domain |
++ More..