Result : EXP01917
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01917 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 1187351 |
| Right | 1187392 |
| Strand | + |
| Nucleotide Sequence | GTGATGGAGCGCTACGGATTTTGTGGGTGTTGTCGGCCCTGA |
| Sequence | VMERYGFCGCCRP |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 13 |
++ More..
| Conservation Analysis |
No. of Species: 19
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1201663 | 1201704 | + | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 2 | 1187351 | 1187392 | + | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
| 3 | 622575 | 622616 | + | NZ_AP022581.1 | Mycobacterium lacus |
| 4 | 2978425 | 2978466 | - | NZ_AP022582.1 | Mycobacterium seoulense |
| 5 | 1073780 | 1073821 | + | NZ_CP009360.4 | Mycobacterium avium subsp. hominissuis |
| 6 | 5447596 | 5447637 | - | NZ_CP025546.1 | Mycobacterium paragordonae |
| 7 | 2406 | 2447 | + | NZ_AP022614.1 | Mycobacterium parmense |
| 8 | 5937781 | 5937822 | + | NZ_AP022614.1 | Mycobacterium parmense |
| 9 | 2907720 | 2907761 | - | NZ_AP022619.1 | Mycobacterium paraseoulense |
| 10 | 1090886 | 1090927 | + | NC_016946.1 | Mycobacterium intracellulare ATCC 13950 |
| 11 | 1099782 | 1099823 | + | NC_016948.1 | Mycobacterium paraintracellulare |
| 12 | 1062053 | 1062094 | + | NZ_CP023147.1 | Mycobacterium marseillense |
| 13 | 3288171 | 3288212 | - | NZ_CP011883.2 | Mycobacterium haemophilum DSM 44634 |
| 14 | 5791239 | 5791280 | + | NZ_AP022590.1 | Mycobacterium mantenii |
| 15 | 4234700 | 4234741 | - | NZ_AP018164.1 | Mycobacterium shigaense |
| 16 | 2435749 | 2435790 | - | NZ_AP022573.1 | Mycobacterium saskatchewanense |
| 17 | 4626129 | 4626170 | - | NZ_AP022613.1 | Mycobacterium conspicuum |
| 18 | 295687 | 295728 | + | NZ_AP022575.1 | Mycobacterium shinjukuense |
| 19 | 5150912 | 5150953 | + | NZ_AP022587.1 | Mycobacterium stomatepiae |
| 20 | 3909043 | 3909084 | + | NZ_AP022568.1 | Mycobacterium simiae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_AP022582.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF13230.8 | 0.89 | 17 | 2565 | same-strand | Glutamine amidotransferases class-II |
| 2 | PF01734.24 | 1.0 | 19 | 654 | opposite-strand | Patatin-like phospholipase |
| 3 | PF17301.4 | 0.84 | 16 | 69.5 | opposite-strand | Putative lipoprotein LpqV |
| 4 | PF00581.22 | 1.0 | 19 | 625.0 | same-strand | Rhodanese-like domain |
| 5 | PF16113.7 | 0.68 | 13 | 3633 | opposite-strand | Enoyl-CoA hydratase/isomerase |
| 6 | PF00378.22 | 0.84 | 16 | 2836 | opposite-strand | Enoyl-CoA hydratase/isomerase |
| 7 | PF10081.11 | 0.84 | 16 | 1071.0 | opposite-strand | Alpha/beta-hydrolase family |
| 8 | PF15420.8 | 0.84 | 16 | 1071.0 | opposite-strand | Alpha/beta-hydrolase family N-terminus |
++ More..