Result : EXP01915
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01915 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 1108568 |
| Right | 1108621 |
| Strand | + |
| Nucleotide Sequence | GTGAGTTCCGTCATTCCCCGCACGGCAGCGCGATCAGCCCGCGCTCCGGTGTGA |
| Sequence | VSSVIPRTAARSARAPV |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 17 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1119375 | 1119428 | + | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 2 | 1108568 | 1108621 | + | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015848.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF02687.23 | 1.0 | 2 | 3459.0 | same-strand | FtsX-like permease family |
| 2 | PF07143.13 | 1.0 | 2 | 2292.0 | same-strand | CrtC N-terminal lipocalin domain |
| 3 | PF17186.6 | 1.0 | 2 | 2292.0 | same-strand | Lipocalin-like domain |
| 4 | PF00348.19 | 1.0 | 2 | 1186.0 | opposite-strand | Polyprenyl synthetase |
| 5 | PF08666.14 | 1.0 | 2 | 469.0 | opposite-strand | SAF domain |
| 6 | PF09723.12 | 1.0 | 2 | 64.0 | opposite-strand | Zinc ribbon domain |
| 7 | PF01812.22 | 1.0 | 2 | -43.0 | opposite-strand | 5-formyltetrahydrofolate cyclo-ligase family |
| 8 | PF00483.25 | 1.0 | 2 | 651.0 | same-strand | Nucleotidyl transferase |
| 9 | PF12804.9 | 1.0 | 2 | 651.0 | same-strand | MobA-like NTP transferase domain |
| 10 | PF03453.19 | 1.0 | 2 | 1648.0 | same-strand | MoeA N-terminal region (domain I and II) |
| 11 | PF03454.17 | 1.0 | 2 | 1648.0 | same-strand | MoeA C-terminal region (domain IV) |
| 12 | PF00994.26 | 1.0 | 2 | 1648.0 | same-strand | Probable molybdopterin binding domain |
| 13 | PF13302.9 | 1.0 | 2 | 2991.0 | same-strand | Acetyltransferase (GNAT) domain |
++ More..