Result : EXP01914
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01914 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 1078545 |
| Right | 1078592 |
| Strand | + |
| Nucleotide Sequence | GTGAAGCCGAGCGCAAGGCCGGGGAGAGCGCCGAGCAAGCTCGACTGA |
| Sequence | VKPSARPGRAPSKLD |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 15 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1088772 | 1088819 | + | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 2 | 1078545 | 1078592 | + | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015848.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF06259.14 | 1.0 | 2 | 2021.5 | opposite-strand | Alpha/beta hydrolase |
| 2 | PF08044.13 | 1.0 | 2 | 709.5 | opposite-strand | Domain of unknown function (DUF1707) |
| 3 | PF02583.19 | 1.0 | 2 | 211.0 | same-strand | Metal-sensitive transcriptional repressor |
| 4 | PF07371.14 | 1.0 | 2 | -47.0 | same-strand | Protein of unknown function (DUF1490) |
| 5 | PF00122.22 | 1.0 | 2 | 85.0 | same-strand | E1-E2 ATPase |
| 6 | PF00702.28 | 1.0 | 2 | 85.0 | same-strand | haloacid dehalogenase-like hydrolase |
| 7 | PF17197.6 | 1.0 | 2 | 2460.0 | same-strand | Domain of unknown function (DUF5134) |
| 8 | PF00378.22 | 1.0 | 2 | 3245.0 | opposite-strand | Enoyl-CoA hydratase/isomerase |
| 9 | PF00441.26 | 1.0 | 2 | 4054.0 | opposite-strand | Acyl-CoA dehydrogenase, C-terminal domain |
| 10 | PF02771.18 | 1.0 | 2 | 4054.0 | opposite-strand | Acyl-CoA dehydrogenase, N-terminal domain |
| 11 | PF02770.21 | 1.0 | 2 | 4054.0 | opposite-strand | Acyl-CoA dehydrogenase, middle domain |
| 12 | PF08028.13 | 1.0 | 2 | 4054.0 | opposite-strand | Acyl-CoA dehydrogenase, C-terminal domain |
| 13 | PF02786.19 | 1.0 | 2 | 5217.0 | opposite-strand | Carbamoyl-phosphate synthase L chain, ATP binding domain |
| 14 | PF00289.24 | 1.0 | 2 | 5217.0 | opposite-strand | Biotin carboxylase, N-terminal domain |
| 15 | PF02785.21 | 1.0 | 2 | 5217.0 | opposite-strand | Biotin carboxylase C-terminal domain |
| 16 | PF00364.24 | 1.0 | 2 | 5217.0 | opposite-strand | Biotin-requiring enzyme |
++ More..